Search the Community

In Day 9 on April 9, 2015, I wrote about how we got the Cushing’s colors of blue and yellow. This post is going to be about the first Cushing’s ribbons. http://cushieblog.files.wordpress.com/2012/04/janice-ribbon.jpg?w=500 I was on vacation in September, 2001 when SuziQ called me to let me know that we had had our first Cushie casualty (that we knew about). The image at the top of the page shows the first blue and yellow ribbon which were worn at Janice’s funeral. When we had our “official ribbons” made, we sent several to Janice’s family. Janice was the first of us to die but there have been more, way too many more, over the years. I’ll write a bit more about that on Day 21.

an-ectopic-cushingrsquos-syndrome-with-severe-psychiatric-presentation-9744.pdf Abstract Ectopic ACTH Secreting (EAS) tumor is relatively rare entity that presents with severe manifestation due to high level of endogenous hypercortisolism and rapidity of its onset. We report a case of severe EAS in a young Tunisian man resulting from a well differentiated Neuroendocrine Tumor (NET) of the lung. Besides catabolic signs and profound hypokalemia orienting towards Cushing’s Syndrome (CS), psychiatric symptoms were particularly severe, dominant and atypical including persecutory delusions, depression and anxiety. After tumor localization, successful resection was performed and the majority of psychiatric symptoms resolved rapidly except for mild depression.

Abstract The occurrence of a second neoplasm possibly constitutes an adverse and uncommon complication after radiotherapy. The incidence of a second pituitary tumor in patients irradiated for adrenocorticotropic hormone secreting pituitary adenoma is rare. We report a case of a 40-year-old female with Cushing disease who underwent surgical management followed by radiotherapy. After 5 years of initial treatment, an increase in tumor size was evident at the same location, with a significant interval growth of the parasellar component of the lesion. Histology revealed an undifferentiated highly malignant sarcoma. In the span of next 2 years, the patient was followed with 2 repeat decompression surgeries and radiotherapy because of significant recurrent compressive symptoms by locally invasive malignant tumor. Despite the best efforts, the patient remained unresponsive to multiple treatment strategies (eg, surgical resections and radiotherapy) and succumbed to death. radiotherapy, second malignancy, Cushing disease Issue Section: Case Report Introduction Radiation therapy is a commonly used modality for primary or adjuvant treatment of pituitary adenoma. It is also used as an adjuvant therapy for Cushing disease with persistent or aggressive tumor growth or recurrent disease after surgery. The immediate sequelae of radiotherapy for pituitary tumors include nausea, fatigue, diminished taste and olfaction, and hair loss [1]. One frequent long-term side effect is hypopituitarism. The incidence rate of new-onset hypopituitarism after conventional radiotherapy is approximately 30% to 100% after a follow-up of 10 years, whereas after stereotactic radiosurgery or fractionated radiotherapy, the incidence is approximately 10% to 40% at 5 years [2]. The occurrence of a second neoplasm after cranial radiotherapy constitutes possibly one of the most adverse complications. Tumors such as meningioma, glioma, and sarcoma are the most frequently reported secondary neoplasms after pituitary irradiation [3]. The cumulative probability of a second brain tumor in patients irradiated for pituitary adenoma and craniopharyngioma is approximately 4% [4]. We report 1 such case with detailed clinical, histopathological, and radiological characteristics because of its rarity and associated high mortality of radiation-induced sarcoma. Case Presentation The patient first presented at 40 years of age with complaints of weight gain, new-onset diabetes mellitus, hypertension, and cushingoid features in 2014. She was diagnosed with Cushing disease (24-hour urinary cortisol 1384 mcg/24 hours [3819 nmol/24 hours; reference >2 upper limit of normal], low-dose dexamethasone suppression test serum cortisol 16.6 mcg/dL [457.9 nmol/L], ACTH 85 pg/mL [18.7 pmol/L; reference range, <46 pg/mL, <10 pmol/L]) caused by invasive adrenocorticotropic hormone-secreting giant adenoma. The initial imaging revealed a homogenously enhanced pituitary macroadenoma with a size of 42 × 37 × 35 mm with suprasellar extension and encasing both the internal carotid arteries with mass effect on optic chiasma and sellar erosion. The patient underwent tumor excision by endoscopic transsphenoidal transnasal approach. Partial excision of the tumor was achieved because of cavernous sinus invasion. Histopathology and immunohistochemical stains demonstrated a corticotrophin-secreting (ACTH-staining positive) pituitary adenoma with MIB labeling index of 1% to 2%. Because biochemical remission was not achieved (urinary cortisol 794 mcg/24 hours [2191 nmol/24 hours]; ACTH 66 pg/mL [14.5 pmol/L; reference range, <46 pg/mL, <10 pmol/L]), the patient was started on ketoconazole and was received fractionated radiotherapy with a dose of 5040 cGy in 28 fractions. Diagnostic Assessment For the next 5 years, at yearly follow-up, 400 mg ketoconazole was continued in view of insufficient control of ACTH secretion. During follow-up, the size of the tumor was stable at approximately 23 × 16 × 33 mm after radiotherapy with no significant clinical and biochemical changes. Five years after surgery and radiotherapy, the patient developed cerebrospinal fluid rhinorrhea; imaging revealed a cystic transformation of the suprasellar component and increase in the size of the tumor to 39 × 22 × 26 mm, which included visualization of a parasellar component of size 29 × 19 × 15 mm. The patient continued on ketoconazole. The patient was also advised to undergo hypofractionated radiotherapy but did not return for follow-up. Treatment In 2021, 1.5 years after the last visit, the patient developed severe headache, altered sensorium, ptosis, focal seizures, and left-sided hemiparesis. During this episode, the patient had an ACTH of 66 pg/mL (14.53 pmol/L; reference range, <46 pg/mL [<10 pmol/L]) and baseline cortisol of 25 mcg/dL (689 nmol/L; reference range, 4-18 mcg/dL [110-496 nmol/L]). Repeat imaging revealed a significant decrease in the suprasellar cystic component but an increase in the size of the parasellar component to 38 × 21 × 25 mm from 29 × 19 × 15 mm, which was isointense on T1 and T2 with heterogeneous enhancement. Significant brain stem compression and perilesional edema was also visible. The patient underwent urgent frontotemporal craniotomy and decompression of the tumor. On pathological examination, the tumor tissue was composed of small pleomorphic round cells arranged in sheets and cords separated by delicate fibrocollagenous stroma. Cells had a round to oval hyperchromatic nucleus with scanty cytoplasm. Areas of hemorrhage, necrosis, and a few apoptotic bodies were seen. The tumor tissue had very high mitotic activity of >10/10 hpf and MIB labeling index of 70%. Immunohistochemistry demonstrated positivity for vimentin, CD99, and TLE-1. Dot-like positivity was present for HMB 45, synaptophysin. INI-1 loss was present in some cells. Ten percent patchy positivity was present for p53. The tumor cells, however, consistently failed to express smooth muscle actin, CD34, Myf-4, epithelial membrane antigen, desmin, LCA, SADD4, CD138, and S-100 protein. ACTH and staining for other hormones was negative. Based on the immunological and histochemical patterns, a diagnosis of high-grade poorly differentiated malignant tumor with a probability of undifferentiated sarcoma was made. Because of the invasion of surrounding structures and surgical inaccessibility, repeat fractionated radiotherapy was given with a dose of 4500 cGy over 25 fractions at 1.8 Gy daily to the planned target volume via image-guided fractionated radiotherapy. During the next 1.5 years, patient improved clinically with no significant increase in the size of tumor (Fig. 1). The patient was gradually tapered from ketoconazole and developed hypopituitarism requiring levothyroxine and glucocorticoid replacement. There was a significant improvement in the power of the left side and ptosis. Figure 1. Open in new tabDownload slide Contrast-enhanced T1 magnetic resonance imaging dynamic pituitary scan (A, sagittal; B, axial; C, coronal sections) reveals postoperative changes with residual enhancing tumor in the right lateral sella cavity with extension into the right cavernous sinus and parasellar region encasing the cavernous and inferiorly extends through the foramen ovale below the skull base up to approximately 1.5 cm. Anteriorly, it extends up to the right orbital apex and posteriorly extends along the right dorsal surface of clivus. Outcome and Follow-up After 1.5 years of reradiation in 2022, the patient again developed palsies of the abducens, trigeminal, oculomotor, and trochlear cranial nerve on the right side and left-sided hemiparesis. A significant increase in tumor size to 50 × 54 × 45 mm with anterior, parasellar, and infratentorial extension was seen (Fig. 2). Again, repeat decompression surgery was done. Two months after surgery, there was no improvement in clinical features and repeat imaging suggested an increased size of the tumor by 30%, to approximately 86 × 68 × 75 mm. Nine years after initial presentation, the patient had an episode of aspiration pneumonia and died. Figure 2. Open in new tabDownload slide Contrast-enhanced T1 magnetic resonance imaging dynamic pituitary images (A, sagittal; B, axial; C, coronal sections) after 1.5 years of a second session of radiotherapy reveal a significant interval increase in size of heterogeneously enhancing irregular soft tissue in sellar cavity with extension into the right cavernous sinus and parasellar region when compared with previous imaging. Superiorly, it extends in the suprasellar region, causing mass effect on the optic chiasma with encasement of the right prechiasmatic optic nerve and right-sided optic chiasma. Inferiorly, the lesion extends into the sphenoid sinus. Posteriorly, there is interval increase in the lesion involving the clivus and extending into the prepontine and interpeduncular cistern. Anteriorly, mass has reached up to the right orbital apex optic nerve canal, which shows mild interval increase. Discussion Radiation-induced tumors were initially described by Cahan et al in 1948. They also described the prerequisites for a tumor to be classified as a radiation-induced sarcoma [5]. The modified Cahan criteria state that (1) the presence of nonmalignancy or malignancy of a different histological type before irradiation, (2) development of sarcoma within or adjacent to the area of the radiation beam, (3) a latent period of at least 3 years between irradiation and diagnosis of secondary tumor, and (4) histological diagnosis of sarcoma, can be classified as radiation-induced sarcoma [5]. Our patient fulfilled the criteria for a radiation-induced sarcoma with a highly malignant tumor on histopathology. Radiation-induced sarcomas after functional pituitary tumors, especially Cushing disease, are rarely reported. One of the case reports revealed a high-grade osteoblastic osteosarcoma 30 years after treatment for Cushing disease with transsphenoidal resection and external beam radiotherapy [6]. In our case, there was a lag period of approximately 5 years before the appearance of a second highly undifferentiated, malignant, histologically distinct tumor. The cellular origin of this relatively undifferentiated tumor cannot be determined with certainty. However, the interlacing sarcomatous and adenomatous components resulting from distinct positive immunohistochemistry may indicate that the sarcomatous component may be derived from the preexisting pituitary adenoma. A hormonally functional pituitary tumor is not itself expected to be associated with an increased risk of secondary malignancy, except in the case of GH-secreting tumors and those with a hereditary cancer syndrome. Although not proven, immunosuppression from hypercortisolism in Cushing disease has been proposed as a contributor to secondary tumor development [7]. Other mechanisms causing increased risk of secondary malignancy can be double-stranded DNA damage and genomic instability caused by ionizing radiation and germline mutations in tumor suppressor genes such as TP53 and Rb [7]. Radiation-induced intracranial tumors were studied in a multicenter, retrospective cohort of 4292 patients with pituitary adenoma or craniopharyngioma. Radiotherapy exposure was associated with an increased risk of a second brain tumor with a rate ratio of 2.18 (95% CI, 1.31-3.62, P < .0001). The cumulative probability of a second brain tumor was 4% for the irradiated patients and 2.1% for the controls at 20 years [7]. In another study including 426 patients irradiated for pituitary adenoma between 1962 and 1994, the cumulative risk of second brain tumors was 2.0% (CI, 0.9-4.4) at 10 years and 2.4% (95% CI, 1.2-5.0) at 20 years. The relative risk of a second brain tumor compared with the incidence in the normal population is 10.5 (95% CI, 4.3-16.7) [8]. The incidence of radiation-induced sarcomas has been estimated at 0.03% to 0.3% of patients who have undergone radiation therapy. The risk of radiation-induced sarcomas increases with field size and dose. In a systemic review and analysis of 180 cases of radiation-induced intracranial sarcomas, the average dose of radiation delivered was 51.4 ± 18.6 Gy and latent period of sarcoma onset was 12.4 ± 8.6 years. A total of 49 cases were developed after radiation treatment of pituitary adenomas (27.2%). The median overall survival time for all patients with sarcoma was 11 months, with a 5-year survival rate of 14.3% [9]. Our patient received approximately 50 Gy twice through fractionated radiotherapy, resulting in larger field size and significantly higher dose than one would expect with a modern stereotactic treatment. Such a high dose of radiation is indeed a risk factor for secondary malignancy. In our patient, in a period of 2 months, there was already >30% tumor growth after recent repeat decompression surgery. The risk of secondary malignancy is thought to be much lower with stereotactic radiosurgery than conventional external beam radiation therapy, with an estimated cumulative incidence of 0.045% over 10 years (95% CI, 0.00-0.34) [10]. However, long-term follow-up data for patients receiving stereotactic radiation therapy are shorter and thus definitive conclusions cannot be made at this stage. Our case highlights a rare but devastating long-term complication of pituitary tumor irradiation after Cushing disease. The limited response to various available treatment options defines the aggressive nature of radiation-induced malignancy. Learning Points The occurrence of a second neoplasm constitutes possibly one of the most adverse and rare complication after radiotherapy. The incidence of radiation-induced sarcomas has been estimated at 0.03% to 0.3% of patients, but cases after Cushing disease are rarely reported. Patients often present with advanced disease unresponsive to various treatment modalities because of aggressive clinical course. New modalities with stereotactic radiosurgery and proton beam therapy are to be reviewed closely for risk assessment of secondary tumor. Acknowledgments The authors acknowledge Dr. Ishani Mohapatra for her support with histopathology and interpretation. Contributors All authors made individual contributions to authorship. G.B., S.K.M., and V.A.R. were involved in diagnosis and management of the patient. G.B. was involved in the writing of this manuscript and submission. V.P.S. was responsible for patient surgeries. All authors reviewed and approved the final draft. Funding The authors received no financial support for the research, authorship, and/or publication of this article. Disclosures The authors have nothing to disclose. Informed Patient Consent for Publication Signed informed consent could not be obtained from the patient or a proxy but was approved by the treating institute. Data Availability Statement Data sharing is not applicable to this article as no data sets were generated or analyzed during the current study. © The Author(s) 2023. Published by Oxford University Press on behalf of the Endocrine Society. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. From https://academic.oup.com/jcemcr/article/1/6/luad119/7343968?login=false

Abstract Introduction: Chronic exposure to excessive endogenous cortisol leads to brain changes in Cushing’s disease (CD). However, it remains unclear how CD affects large-scale functional networks (FNs) and whether these effects are reversible after treatment. This study aimed to investigate functional network changes of CD patients and their reversibility in a longitudinal cohort. Methods: Active CD patients (N = 37) were treated by transsphenoidal pituitary surgery and reexamined 3 months later. FNs were computed from resting-state fMRI data of the CD patients and matched normal controls (NCs, N = 37). A pattern classifier was built on the FNs to distinguish active CD patients from controls and applied to FNs of the CD patients at the 3-month follow-up. Two subgroups of endocrine-remitted CD patients were identified according to their classification scores, referred to as image-based phenotypically (IBP) recovered and unrecovered CD patients, respectively. The informative FNs identified by the classification model were compared between NCs, active CD patients, and endocrine-remitted patients as well as between IBP recovered and unrecovered CD patients to explore their functional network reversibility. Results: All 37 CD patients reached endocrine remission after treatment. The classification model identified three informative FNs, including cerebellar network (CerebN), fronto-parietal network (FPN), and default mode network. Among them, CerebN and FPN partially recovered toward normal at 3 months after treatment. Moreover, the informative FNs were correlated with 24-h urinary-free cortisol and emotion scales in CD patients. Conclusion: These findings suggest that CD patients have aberrant FNs that are partially reversible toward normal after treatment. Journal Section: Research Article Keywords: Cushing’s disease, Reversibility, Functional networks, Cortisol, Emotion Introduction Cushing’s disease (CD) is characterized by chronic exposure to excessive endogenous glucocorticoid most commonly caused by an adrenocorticotropic hormone (ACTH) pituitary adenoma [1, 2]. The CD is accompanied by multiple physical manifestations such as hypertension and osteoporosis, as well as various neuropsychiatric symptoms including memory lapses, attention deficits, executive function decline, emotional dysfunction, visual-spatial disability, and language defects [3‒14]. These neuropsychiatric symptoms are indicative of the effects of CD on the brain anatomy and function. Therefore, CD provides a unique and naturalistic model for investigating both the effects of hypercortisolism on the human brain and the reversibility of these effects after resolution of hypercortisolism. Recent studies have documented brain structural and metabolic abnormalities in CD patients with a variety of neuroimaging techniques, including structural magnetic resonance imaging (sMRI) [11, 12, 15‒24], diffusion tensor imaging [10, 25‒27], proton magnetic resonance spectroscopy [21, 28‒30], positron emission topography [21, 31], and arterial spin labeling [32]. These studies have shown that brain structural and metabolic abnormalities in CD patients can be partially restored after resolution of hypercortisolism [16, 18, 20‒22, 24, 32‒34], typically after transsphenoidal pituitary surgery (TSS), a safe and effective first-line treatment with a high endocrine remission rate [35, 36]. Several functional magnetic resonance imaging (fMRI) studies have also documented brain functional abnormalities in CD patients [37‒42]. Particularly, aberrant functional connectivity between the anterior cingulate cortex and the limbic network, as well as the lateral occipital cortex and the default mode network (DMN) was observed in endocrine-remitted CD patients after TSS treatment in a cross-sectional resting-state fMRI (rs-fMRI) study [40]. However, the causal effects of hypercortisolism on brain functional connectivity cannot be well investigated in CD patients only through the cross-sectional study. Additionally, the large-scale functional networks (FNs) of CD patients were not well investigated through univariate analyses in previous studies, which only examined one or few FNs in CD patients independently [37‒42]. The present study aims to jointly investigate a number of whole-brain large-scale intrinsic FNs and their reversibility due to hypercortisolism in CD patients based on rs-fMRI with a longitudinal design through multivariate analysis. Particularly, intrinsic FNs altered by CD were identified using a multivariate pattern classification model optimized by selecting intrinsic FNs informative for distinguishing CD patients from matched normal controls (NCs). The changes in these informative FNs of endocrine-remitted CD patients after TSS treatment were quantified at the 3-month follow-up with the established pattern classification model. Furthermore, changes in clinical measures, including serum cortisol, 24-h urinary-free cortisol (24hUFC), ACTH, self-rating depression scale (SDS), and self-rating anxiety scale (SAS), were detected between active and endocrine-remitted CD patients using pseudo paired t tests. Finally, the association between aberrant FNs and clinical measures was investigated in CD patients. Materials and Methods Participants In this study, 50 CD patients undergoing TSS, and 38 NCs with no history of glucocorticoid treatment were recruited at the Department of Neurosurgery, Peking Union Medical College Hospital. All these participants were assessed for depression and anxiety measured by the SDS and SAS, respectively [43]. The inclusion criteria for NCs were no past or present heart history of disease, atherosclerosis, hyperlipidemia, diabetes, neurological/psychiatric disorders, and claustrophobia. The exclusion criteria for both CD patients and NCs were past or present brain trauma, other neurological disorders, history of radiotherapy, or contraindications to MRI. Besides the inclusion and exclusion criteria, the quality of the imaging data was controlled as follows. No participant had head motion exceeding 2.0 mm translation in any of the three directions or exceeding 2.0o maximum rotation around any of the axes during rs-fMRI scanning [44]. Additionally, no participant had root-mean-square value of maximum frame-wise displacement greater than 0.3 mm [45]. After quality control of the imaging data, 37 CD patients and 37 sex-, age-, and education level-matched NCs were included in the study. The diagnosis of active CD was confirmed by experienced endocrinologists along with dynamic enhanced pituitary MRI, low- and high-dose dexamethasone suppression tests, and/or inferior petrosal sinus sampling in accordance with the latest clinical practice guidelines [46]. The 37 active CD patients were treated with TSS rather than radiotherapy. All of the 37 CD patients reached endocrine remission after treatment, which was confirmed by their normal serum cortisol (<5 µg/dL within 7 days of surgery) [46]. These patients were asked to revisit the hospital for reexamination 3 months after surgery, and all of them had no recurrence at the 3-month follow-up. Serum cortisol, 24hUFC, and ACTH were measured by direct chemiluminescence immunoassays in CD patients before surgery and at the 3-month follow-up (Siemens Healthcare Diagnostics Inc., USA). This study was approved by the Medical Ethics Committee of Peking Union Medical College Hospital, and written informed consent was obtained from all participants after explaining to them the nature of the study. Imaging Data Acquisition The MRI data were scanned by using an 8-channel phase-array head coil with a 3.0-Tesla MR scanner (Discovery MR750, General Electric) for all participants, including NCs, active CD patients, and endocrine-remitted CD patients without recurrence at the 3-month follow-up. The rs-fMRI data were acquired axially by using a gradient echo-planar imaging sequence, and the scanning parameters were 200 whole-brain volumes, 36 transverse slices with a thickness of 4 mm, in-plane resolution = 3.75 × 3.75 mm2, field of view = 240 × 240 mm2, flip angle = 90°, repetition time = 2,000 ms, and echo time = 30 ms. The extra high-resolution sagittal 3D T1-weighted data were acquired by using a brain volume sequence, and the scanning parameters were 172 slices with a thickness of 1.0 mm, in-place matrix = 512 × 512, field of view = 256 × 256 mm2, voxel size = 0.5 × 0.5 × 1.0 mm3, flip angle = 12°, repetition time = 7.2 ms, echo time = 3.2 ms, and inversion time = 400 ms. Imaging Data Preprocessing The rs-fMRI data were preprocessed as follows: (1) discarding the first four volumes of the fMRI data; (2) correction for slice timing; (3) 3D rigid-body correction for head motion to the middle frame of the data; (4) global 4D intensity scaling of the fMRI data to yield a mean value of 10,000; (5) nonlinear registration of the fMRI data to the MNI template with the deformation field obtained from its co-registered T1-weighted data using DARTEL within statistical parametric mapping (SPM12) software, with a resampled resolution of 3×3×3 mm3; (6) spatial smoothing with a 6-mm full-width at half maximum Gaussian kernel; (7) motion artifacts removal from fMRI data with ICA-AROMA; (8) regressing out averaged signals of white matter, cerebrospinal fluid, and whole brain; (9) temporal band-pass filtering (0.009–0.08 Hz). The preprocessing procedures were performed by using SPM12 software (https://www.fil.ion.ucl.ac.uk/spm/software/spm12/). Identification of Informative FNs in Active CD Patients The flowchart for identifying informative FNs in active CD patients is shown in Figure 1. First, group information-guided independent component analysis was applied to rs-fMRI data of each participant from NCs, active CD patients, and endocrine-remitted CD patients at 3 months after treatment to extract subject-specific independent components (ICs), referred to as intrinsic FNs [47] (Fig. 1a). Specifically, group-level ICs were computed based on all participants from NC, active CD, and endocrine-remitted CD groups, by using the multivariate exploratory linear optimized decomposition into independent components (MELODIC) toolbox in FSL software (https://fsl.fmrib.ox.ac.uk/fsl/fslwiki/melodic). These group-level ICs were used as guidance information to compute subject-specific ICs of all individuals [47]. The number of ICs was empirically set to be 25, and therefore each individual was characterized by 25 FNs. Particularly, these FNs were restricted to gray matter in order to minimize the partial volume effects of cerebrospinal fluid and confounding effects on the estimated components, and to improve the sensitivity to the changes of blood-oxygen-level-dependent signals. Fig. 1. VIEW LARGEDOWNLOAD SLIDE Flowchart of the multivariate pattern classification method for distinguishing active CD patients from NCs, including data preparation (a), classification modeling (b), as well as identifying CD-associated ICs (c). CD, Cushing’s disease; active CD patients, CD patients before treatment; NCs, normal controls; rs-fMRI, resting-state functional magnetic resonance imaging; ICs, independent components; GIG-ICA, group information-guided ICA; SVM, support vector machine; LOOCV, leave-one-out cross-validation. Subsequently, a multivariate pattern classification method based on support vector machine (SVM) was applied to identify cross-sectional informative FNs, which were most discriminative in distinguishing active patients from NCs [48] (Fig. 1b). Specifically, sigmoid kernel SVM classifiers were built upon a subset of 25 FNs obtained via a forward selection technique to optimize the classification performance for differentiating active patients from NCs. The similarity between subjects in SVM classification was defined as the Riemannian distance of the subset of FNs on the Grassmann manifold [48, 49]. Initially, the forward component selection procedure built a classifier on each individual FN, and the performance of the classifier was estimated using leave-one-out cross-validation (LOOCV) so that each FN could be evaluated for its classification performance. The accuracy rate was chosen as the main metric for evaluating the classification performance. The FN with the best performance was selected to be included in the subsequent classification. Through combining the first selected FN and any one of the remaining FNs, classifiers were built upon all paired FNs which were evaluated based on the training data during the current outer round using an inner LOOCV procedure. The paired FNs with the best performance were selected to be included in the classification. The procedure was repeated to add more FNs in the classification one by one until a single classifier was built upon all available FNs. Accordingly, a subset of FNs with the best performance was deemed to be the final selected components in the classification, hereafter referred to as informative FNs. To avoid potential classification biases, a nested LOOCV procedure was applied to optimize the parameters of the sigmoid kernel SVM classifiers to improve the classification performance during the forward component selection procedure [48, 49]. Since different FNs might be selected in each training runs or each testing run during the nested LOOCV procedure, the informative FNs were selected as the best performing ones with higher frequency (selection frequency>0.5). Based on these informative FNs of 74 subjects (including 37 NCs and 37 active CD patients), the LOOCV classification model yielded 74 aggregated SVM classifiers with the nested LOOCV classifiers, respectively. Each aggregated classifier generated a classification score from its corresponding nested classifiers with a positive value indicating CD state and a negative value indicating healthy state. Finally, the classification performance was evaluated with metrics including classification accuracy, specificity, sensitivity, and the area under the receiver operating characteristic curve (AUROC) (Fig. 1c). Non-parametric permutation tests were adopted to examine the statistical significance of the classification performance. The classification rate for the null distribution was estimated by building sigmoid kernel SVM models upon cross-sectional informative FNs of all active CD patients and NCs with subject labels randomly permuted by using the LOOCV strategy. This procedure was repeated for 10,000 times. Finally, the null distribution of the classification rate based on permuted samples was obtained. Longitudinal Analyses of Informative FNs and Emotion Scales from Active to Endocrine-Remitted CD Patients To investigate the longitudinal functional connectivity changes, pseudo paired t tests between active and endocrine-remitted CD patients (10,000 permutations) were applied voxel-wisely to each of the informative FNs using statistical non-parametric mapping (SnPM) software (http://warwick.ac.uk/snpm). Brain regions with statistical significance within each informative FN were identified at a voxel-wise threshold of p < 0.01 and an extent threshold of 40 adjacent voxels (AlphaSim-corrected p < 0.01). Additionally, statistical analyses were performed to compare the IC’s z scores of FNs as well as emotion scales between any pair of NC, active CD, and endocrine-remitted CD groups to further examine the longitudinal brain functional connectivity changes. Particularly, a pseudo paired t test was applied to all IC’s z scores within each informative FN as well as SDS scores and SAS scores between active and endocrine-remitted CD patients (10,000 permutations). While a pseudo two-sample t test with age, sex, and years of school education as covariates was applied to all IC’s z scores within each informative FN as well as SDS scores and SAS scores between NCs and active CD patients and endocrine-remitted CD patients. Significant differences were determined at a false discovery rate (FDR) threshold of p < 0.05 after adjusting for multiple comparisons. Statistical Analyses of Informative FNs in Endocrine-Remitted CD Patients The established pattern classification model was applied to the FNs of the follow-up endocrine-remitted CD patients. Thus, each endocrine-remitted CD patient had a classification score that reflected the likelihood of the endocrine-remitted CD patient to be active CD or healthy state (a positive value indicating active CD state and a negative value indicating healthy state). Based on the follow-up classification scores, endocrine-remitted CD patients who were correctly classified as active CD patients before treatment were further stratified into two subgroups: subjects with negative classification scores, referred to as image-based phenotypically (IBP) recovered CD patients, and those with positive classification scores, referred to as IBP unrecovered CD patients. Additionally, statistical differences in the IC’s z scores within each of the informative FNs between the IBP recovered and unrecovered CD patients, were assessed to elucidate these endocrine-remitted CD patients’ brain recoveries in these informative FNs at 3 months after treatment. Specifically, a pseudo two-sample t test with age, sex, years of school education, and years of disease duration as covariates was applied to all IC’s z scores of each FN between IBP recovered and unrecovered CD patients, and significant differences were determined at an FDR threshold of p < 0.05 (10,000 permutations) after adjusting for multiple comparisons. Correlation Analyses between Informative FNs and Clinical Measures Correlation analyses were performed to investigate the relationship between informative FNs and clinical measures in all 37 CD patients. The clinical measures of interest were serum cortisol, 24hUFC, ACTH, SDS, and SAS. Specifically, the correlation between each clinical measure and the averaged IC’s z score of each informative FN of CD patients before treatment was computed using a general linear model with age, sex, years of school education, and years of disease duration as covariates. Significant correlations were determined at a threshold of p < 0.05 using FDR corrected for multiple comparisons. Additionally, the correlation between the changes of each clinical measure and the averaged IC’s z score of each informative FN for endocrine-remitted CD patients before and after treatment was computed by using a general linear model with age, sex, years of school education, years of disease duration, and this clinical measure before treatment as covariates. The change of the averaged IC’s z score of each informative FN for each CD patient was calculated as the value after treatment minus the value before treatment divided by the value before treatment, and the change of each clinical measure for each CD patient was calculated similarly. Significant correlations were identified at a threshold of p < 0.05 using FDR corrected for multiple comparisons. Results Demographics and Clinical Characteristics The demographic and clinical data, including age, sex, years of school education, hormones, and emotion scales, are summarized in Table 1. There were no significant differences in age, sex, and years of school education between NCs and CD patients before treatment or at the 3-month follow-up (p > 0.05). The hormone levels, including ACTH, 24hUFC, and serum cortisol, were significantly restored (lower to be precise) in endocrine-remitted CD patients at the 3-month follow-up compared to their pre-treatment levels (FDR-corrected p < 0.05). These CD patients reached endocrine remission confirmed by their normal serum cortisol (<5 µg/dL) within 7 days of surgery. The emotion scales, including SDS scores and SAS scores, were significantly improved (smaller to be precise) in endocrine-remitted CD patients at 3 months after treatment compared to their rating scales in active phase (FDR-corrected p < 0.05), and the SDS scores and SAS scores for these endocrine-remitted CD patients were comparable to those of NCs. There was also significant difference in SDS scores between endocrine-remitted CD patients and NCs (FDR-corrected p < 0.05), while no significant difference was found in SAS scores between endocrine-remitted CD patients and NCs (p = 0.70). These psychometric comparison results suggest that depressive symptoms were partially recovered in endocrine-remitted CD patients, while their anxiety symptoms were also not completely recovered. Table 1. Demographic and clinical data of the participants Characteristics NCs (N = 37) Active CDs (N = 37) Endocrine-remitted CDs (N = 37) p value Age, years 38.46±11.85 33.92±8.57 33.92±8.57 0.062a Sex (M/F) 10/27 8/29 8/29 0.83a Years of school education 12.84±3.53 13.27±3.11 13.27±3.11 0.55a ACTH, pg/mL - 75.70 (45.55, 103.25) 23 (10.33, 30.70) <0.01**b 24hUFC, μg/day - 582.34 (351.30, 991.56) 47.77 (14.41, 186.54) <0.01**b Serum cortisol, μg/dL - 26.58 (20.98, 31.84) 5.49 (1.75, 13.69) <0.01**b Depression (SDS) 38.72±7.45 53.99±9.20 45.54±10.24 <0.01**c <0.01**d Anxiety (SAS) 33.34±5.46 45.27±11.92 34.46±9.78 <0.01**c 0.70d Values for characteristics are presented as mean ± SD or median (25th percentiles, 75th percentiles) unless otherwise indicated. Group differences in age, years of school education, SDS, and SAS between NCs and CD patients before or at the 3-month follow-up were examined using pseudo two-sample t tests. Group differences in sex between NCs and the CD patients before treatment or at the 3-month follow-up were examined using a χ2 test. Group differences in ACTH, 24hUFC, serum cortisol, SDS, and SAS between CD patients before treatment and at the 3-month follow-up were examined using pseudo paired t tests. NCs, normal controls; CDs, patients with Cushing’s disease; ACTH, adrenocorticotropic hormone; 24hUFC, 24-h urinary-free cortisol; SDS, self-rating depression scale; SAS, self-rating anxiety scale; M, male; F, female; SD, standard deviations. **p < 0.01. aNCs versus active or endocrine-remitted CDs. bActive CDs versus endocrine-remitted CDs. cActive CDs versus NCs or endocrine-remitted CDs. dNCs versus endocrine-remitted CDs. Informative FNs in Active CD Patients Active CD patients were mostly different from the NCs in 3 out of 25 FNs (selection frequency>0.5), including cerebellar network (CerebN), fronto-parietal network (FPN), and DMN, as shown in Figure 2a and b. The classification models built upon these three informative FNs yielded an accuracy of 72% (sensitivity: 68%, specificity: 76%, AUROC: 0.81), as shown in Figure 2c. Non-parametric permutation tests demonstrated that the classification accuracy was promising and significant (p < 1.0e−04), as suggested by the histogram of permuted classification rates shown in Figure 2d. Particularly, 25 out of 37 (67%) CD patients were correctly classified as active CD patients before treatment. Fig. 2. VIEW LARGEDOWNLOAD SLIDE Three informative functional brain networks identified by the multivariate pattern classification method and the classification performance. a Three highly selected functional brain networks, including CerebN, FPN, and DMN, for differentiating active CD patients from NCs. b The frequency of the functional brain networks selected in the nested LOOCV experiments. c The receiver operating characteristic (ROC) curve (area under the ROC curve [AUROC] = 0.81) of the classification model built upon the selected most discriminative FNs. d The histogram of the classification rates of the permutation tests and the real classification rate. In panel (a), brain regions with significant functional connectivity were obtained by applying voxel-wise one-sample t tests to the IC’s z scores for each of the FNs across all active CD patients and NCs (p < 0.05, FWE corrected for multiple comparisons, and cluster size >400 voxels). CerebN, cerebellar network; FPN, fronto-parietal network; DMN, default mode network; CD, Cushing’s disease; Pres, CD patients before treatment (i.e., active CD patients); NCs, normal controls; FNs, functional networks; ICs, independent components; FWE, family-wise error; L, left; R, right. Changes in Informative FNs from Active to Endocrine-Remitted CD Patients Two out of the three informative FNs, i.e., CerebN and FPN other than DMN, exhibited significant functional connectivity changes in CD patients between active and endocrine-remitted states (Fig. 3a). Compared with their active state, the endocrine-remitted CD patients had significantly improved (increased to be precise) functional connectivity measured by IC’s z scores in both CerebN and FPN circuits at 3 months after treatment. These results indicate that the FNs of the endocrine-remitted CD patients partially recovered toward the NCs at 3 months after treatment (Fig. 3b). Fig. 3. VIEW LARGEDOWNLOAD SLIDE Two informative functional brain networks as well as emotion scales with significant longitudinal changes in CD patients before treatment and at the 3-month follow-up. a Brain regions with significant longitudinal changes in functional connectivity within circuits of CerebN and FPN for CD patients, identified using non-parametric permutation tests (AlphaSim-corrected p < 0.01). b, c Significantly different functional connectivity measured by IC’s z scores across voxels within circuits of CerebN and FPN as well as emotion scales measured by the self-rating depression scale (SDS) and self-rating anxiety scale (SAS) between any two of NCs, CD patients before the treatment (i.e., active CD patients), and endocrine-remitted CD patients at 3-month follow-up (FDR-corrected p < 0.05). A pseudo paired t test with age, sex, and years of school education as covariates was conducted to compare all IC’s z scores within each functional network as well as the SDS scores and SAS scores between CD patients before treatment and at the 3-month follow-up. While a pseudo two-sample t test with age, sex, and years of school education as covariates was conducted to compare IC’s z scores within each functional network as well as SDS scores and SAS scores between NCs and CD patients before treatment, and endocrine-remitted CD patients at 3-month follow-up. CerebN, cerebellar network; FPN, fronto-parietal network; CD, Cushing’s disease; Pres, CD patients before treatment; Posts, endocrine-remitted CD patients at 3-month follow-up; NCs, normal controls; ICs, independent components; FDR, false discovery rate. Changes in Informative FNs of Endocrine-Remitted CD Patients Among the endocrine-remitted CD patients who were correctly classified as active CD patient before treatment, 14 participants were classified as IBP-recovered patients, while 11 participants were classified as IBP-unrecovered patients. The IBP-recovered and -unrecovered CD patients were determined by using the established pattern classification model according to the opposite signs in their classification scores based on their follow-up rs-fMRI data at 3 months after treatment (Fig. 4b). The IBP recovered patients had better recovery of the impaired functional connectivity within the circuits of CerebN and FPN than the IBP-unrecovered patients, as shown in Figure 4a. Fig. 4. VIEW LARGEDOWNLOAD SLIDE Differences in functional connectivity measured by IC’s z scores across voxels within circuits of CerebN and FPN as well as classification scores between image-based phenotypically (IBP)-recovered and -unrecovered CD patients after treatment. In panel (a), statistical comparisons were performed using pseudo two-sample t tests with age, sex, years of school education, and years of disease duration as covariates (FDR-corrected p < 0.05). In panel (b), violin plots showed opposite signs in classification scores between IBP-recovered and -unrecovered CD patients. CerebN, cerebellar network; FPN, fronto-parietal network; CD, Cushing’s disease; CDs, patients with Cushing’s disease; ICs, independent components; FDR, false discovery rate. Relationship between Informative FNs and Clinical Measures Changes of 24hUFC for endocrine-remitted CD patients before and after treatment were negatively correlated with their changes of averaged IC’s z scores within the FPN circuits with statistical significance (r = −0.37, p = 0.020), as shown in Figure 5a. The emotion scales, including SDS and SAS, were significantly negatively correlated with the averaged IC’s z scores within the CerebN circuits in the active CD patients (r = −0.31, p < 0.042), as shown in Figure 5c and d. There was no significant correlation for other clinical measures. Fig. 5. VIEW LARGEDOWNLOAD SLIDE Correlations between clinical measures and averaged IC’s z scores of informative FNs in CD patients (FDR-corrected p < 0.05). a Scatter plot for the significantly negative correlation between changes in the averaged IC’s z scores of the FPN circuits and 24hUFC of these 37 endocrine-remitted CD patients. b Multi-slice view of the FPN circuits whose changes in the averaged z scores were significantly correlated with changes in 24hUFC for all 37 endocrine-remitted CD patients before and after treatment. c, d Scatter plots for the significantly negative correlations between the averaged IC’s z scores of the CerebN circuits, and the SDS scores and SAS scores in these 37 endocrine-remitted CD patients before treatment. In panel (a), the changes in the averaged IC’s z scores of the FPN circuits were adjusted by regressing out covariates including age, sex, years of school education, years of disease duration, and the pre-treatment 24hUFC. In panels (c) and (d), the averaged IC’s z scores of the CerebN circuits were adjusted by regressing out covariates including age, sex, years of school education, and years of disease duration. 24hUFC, 24-h urinary-free cortisol; SDS, self-rating depression scale; SAS, self-rating anxiety scale; FPN, fronto-parietal network; CerebN, cerebellar network; CD, Cushing’s disease; Pres, CD patients before treatment; Posts, endocrine-remitted CD patients at 3-month follow-up; ICs, independent components; FDR, false discovery rate. Discussion The present study investigated the large-scale FNs of CD patients before and after treatment based on longitudinal rs-fMRI data. To the best of our knowledge, this is the first study to characterize longitudinal large-scale functional brain network changes due to hypercortisolism in CD patients using multivariate analysis. Particularly, the active CD patients had aberrant functional connectivity within circuits of CerebN, FPN, and DMN, respectively. More importantly, the impaired functional connectivity within the circuits of the CerebN and FPN was partially recovered in the endocrine-remitted CD patients, respectively. The changes in 24hUFC of CD patients before and after treatment were correlated with their changes in the functional connectivity of the FPN circuits. In addition, the emotion scales, including SDS and SAS, were also correlated with the functional connectivity of the CerebN circuits in CD patients before treatment. Aberrant FNs in Active CD Patients The informative FNs identified by the multivariate method were able to distinguish active CD patients from NCs with an accuracy of 72% (sensitivity: 68%, specificity: 76%, AUROC: 0.81). The non-parametric permutation tests also suggested that the multivariate method performed well in differentiating active CD patients from NCs. The most frequently selected FNs (Fig. 2b), i.e., informative FNs, were CerebN, FPN, and DMN. The cross-sectional multivariate analyses have revealed that the active CD patients were mostly different from the NCs in the functional connectivity within 3 FNs out of 25 FNs, as shown in Figure 2a. The aforementioned cross-sectional results provided new insights into large-scale functional brain network abnormalities due to hypercortisolism in CD patients. Particularly, our study revealed that active CD patients had significantly disrupted functional connectivity within the cerebellum (Fig. 2a, 3b), and their emotional dysfunctions observed by the SDS and SAS were associated with the impaired functional connectivity within the cerebellum (Fig. 5c, d). Therefore, it was reasonable to speculate that the cognitive or emotional dysfunctions for active CD patients, documented in this study as well as numerous previous studies [3‒5, 7‒9, 11‒14, 50], might be closely related to the observed functional connectivity abnormalities in the cerebellum. Additionally, our study found that the functional connectivity within the FPN circuits was significantly reduced in active CD patients (Fig. 2a, 3b). It was postulated that cognitive impairments in active CD patients, reported in several early studies [6, 14, 51], might be associated with the observed functional connectivity abnormalities in the FPN circuits. While several recent studies reported that active CD patients had structural or metabolic abnormalities in two brain regions of the FPN, namely, the middle frontal gyrus and inferior parietal lobule [17, 21, 32] These local morphological or metabolic abnormalities might exacerbate the observed functional network (FPN) alterations in active CD patients. Moreover, our study found that the functional connectivity within the DMN circuits was vulnerable to the detrimental effects of hypercortisolism in active CD patients. Besides our finding, recent studies reported that active CD patients showed structural, metabolic, or spontaneous activity abnormalities in several brain regions of DMN, including the posterior cingulate cortex, precuneus, parahippocampal gyrus, ventral medial prefrontal cortex, superior frontal gyrus, inferior temporal gyrus, and lateral parietal cortex [21, 27, 30‒32, 38, 52] These local morphological, metabolic or activity abnormalities might exacerbate the newly discovered DMN impairments in active CD patients. Essentially, the functional, morphological, and metabolic abnormalities in regions of the DMN might be directly related to the adverse expressions of glucocorticoid receptor genes within these brain regions caused by excessive exposure to endogenous cortisol [53]. Reversible Impaired FNs in Endocrine-Remitted CD Patients after Treatment The longitudinal statistical analysis has revealed that the endocrine-remitted CD patients’ hormones, including ACTH, 24hUFC, and serum cortisol, maintained near-normal levels at 3 months after treatment, suggesting that these patients did not relapse according to the endocrine hormone levels (Table 1). Meanwhile, their functional connectivity within circuits of the FPN and CerebN was partially restored at the 3-month follow-up after resolution of hypercortisolism (Fig. 3b). Particularly, our combined longitudinal and cross-sectional study found that the functional connectivity within the FPN circuits in endocrine-remitted CD patients was partially restored after treatment. While a cross-sectional sMRI study reported that endocrine-remitted CD patients still had structural abnormalities in the FPN-related region, namely, the middle frontal gyrus [17]. Our study also found that the functional connectivity of the cerebellum in endocrine-remitted CD patients was partially restored after treatment (Fig. 3b). Besides this finding, two other cross-sectional sMRI studies reported that the structural abnormalities of the cerebellum in endocrine-remitted patients were present as well [16, 20]. Taken together, it was postulated that the reversibility of the observed functional connectivity impairments within circuits of the FPN and CerebN might be directly influenced by their local morphological abnormalities in endocrine-remitted CD patients. Moreover, our study uncovered that the IBP-recovered patients exhibited better recovery of the functional connectivity within circuits of the FPN and CerebN than the IBP-unrecovered ones, as shown in Figure 4a. This result demonstrated that different endocrine-remitted CD patients had different recovery levels for the impaired functional connectivity within circuits of these brain FNs. More importantly, our study further found that the recovered 24hUFC was associated with the improved functional connectivity within FPN circuits in endocrine-remitted CD patients at the 3-month follow-up after treatment (Fig. 5a). This finding indicated that chronic endogenous hypercortisolism in CD patients might be directly related to their FPN impairments. Strengths of This Study The combined longitudinal and cross-sectional analyses have confirmed that the brain functional network abnormalities in CD patients were partially reversible at 3 months after resolution of the hypercortisolism. Since the brain structural abnormalities in endocrine-remitted CD patients were not completely recovered [16], it merits further investigation how the brain structural and functional network recoveries couple with each other in a longitudinal design. The present study provided complementary information to existing neuroimaging studies of CD patients. The existing neuroimaging studies have reported that CD patients had brain volume loss in cortical and cerebellar regions, hippocampus, and amygdala, as well as enlarged ventricles. These structural abnormalities were partially recovered for endocrine-remitted CD patients after treatment [11, 15, 16, 18‒22, 24] or after resolution of the hypercortisolism [12, 18, 24]. CD patients also had reduced cortical thickness in many brain regions including superior frontal cortex, caudal middle frontal cortex, precentral gyrus, insula, precuneus, cuneus, caudal/rostral anterior cingulate gyrus, and posterior cingulate gyrus [17, 54]. In addition, disrupted white matter integrity was observed in CD patients throughout the brain including frontal lobe, temporal lobe, hippocampus, parahippocampal gyrus, cingulate cingulum, corpus callosum, uncinate fasciculus, and cerebellum [10, 25‒27]. Furthermore, metabolic abnormalities in CD patients have been reported in widely distributed brain regions [21, 28‒32], which could be almost completely restored after resolution of hypercortisolism. Besides aforementioned structural and metabolic abnormalities, functional abnormalities have also been reported in CD patients using fMRI [37‒42]. Particularly, abnormal functional activations in CD patients have been observed in the prefrontal cortex, superior/middle/inferior frontal gyrus, superior parietal lobule, superior/middle temporal gyrus, inferior occipital gyrus, rostral/dorsal anterior cingulate gyrus, anterior/middle/posterior hippocampus, amygdala, precuneus, cuneus, lingual gyrus, caudate body, pulvinar/lateral posterior nuclei of the thalamus, and substantia nigra using task fMRI [37‒39, 41]. Abnormal spontaneous functional activities measured by both the amplitude of low-frequency fluctuation and regional homogeneity for CD patients have been observed in the prefrontal cortex, occipital lobe, postcentral gyrus, posterior cingulate gyrus, precuneus, thalamus, and cerebellum [20]. The dysregulation of functional connectivity density of CD patients has been found primarily in the prefrontal cortex, lateral parietal cortex, anterior/posterior cingulate gyrus, and parahippocampal gyrus [55]. The abnormal functional connectivity for CD patients has also been observed between the prefrontal cortex and medial temporal lobe, ventromedial prefrontal cortex and posterior cingulate cortex, anterior cingulate gyrus and limbic network, and lateral occipital cortex and DMN using task fMRI or rs-fMRI [39, 40]. Limitations and Future Work This study has several limitations. First, the longitudinal sample size is not large enough due to the rarity of CD, which might lead to relatively low statistical power and potential biases. Second, our study mainly investigated the brain functional network reversibility of the CD. Studies of the CD’s structural reversibility may provide complementary information to the current study. Third, our study investigated the short-term (3 months) effects of hypercortisolism on large-scale functional brain networks in CD patients. Nevertheless, the long-term effects of hypercortisolism on large-scale functional brain networks remain unclear and merit further investigation. In future work, long-term follow-up data of the CD patients recruited in the current study will be collected to investigate the long-term dynamic changes of their impaired large-scale functional brain networks. Conclusion This is the first study to investigate large-scale functional brain networks and their reversibility in a longitudinal CD cohort by using multivariate analysis. The large-scale functional brain networks, including the CerebN, FPN, and DMN, were impaired due to elevated cortisol levels in active CD patients. More importantly, the impaired functional brain networks of these CD patients were partially restored when their hormone levels returned to normal at 3 months after treatment. The changes of the functional connectivity within the impaired FPN were correlated with changes of the 24hUFC in endocrine-remitted CD patients, while the functional connectivity within the impaired CerebN was closely associated with emotion dysfunctions in active CD patients. These findings suggest that pattern recognition techniques could help identify informative functional brain networks in CD patients, which may help open up novel avenues for their postoperative interventions and assessments after endocrine remission. Statement of Ethics This study confirmed to the Declaration of Helsinki and was approved by the Medical Ethics Committee of Peking Union Medical College Hospital (approval number S-424). Written informed consent was obtained from all participants. Conflict of Interest Statement All authors reported no financial interests or potential conflicts of interest. Funding Sources This study was supported in part by the China Postdoctoral Science Foundation (2020T130070, 2019M650567), and the Clinical Application Research of Capital Characteristic Fund from the Beijing Municipal Science and Technology Commission (Z151100004015099). Author Contributions Bing Xing, Feng Feng, and Yong Fan were involved in study conception and design. Bo Hou, Xiaopeng Guo, Yong Yao, and Ming Feng collected clinical and imaging data. Hewei Cheng, Lu Gao, and Rixing Jing performed data preparation and statistical analysis. Hewei Cheng, Lu Gao, Rixing Jing, Bing Xing, Feng Feng, and Yong Fan were involved in data interpretation. Hewei Cheng, Lu Gao, and Rixing Jing wrote the first draft of the manuscript. Hewei Cheng, Lu Gao, Rixing Jing, Bo Hou, Xiaopeng Guo, Zihao Wang, Ming Feng, Bing Xing, Feng Feng, and Yong Fan provided critical editing and revision of the manuscript for important intellectual content. All authors approved the final version of the manuscript. Additional Information Hewei Cheng and Lu Gao contributed equally to this work. Data Availability Statement All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author. References 1. Newell-Price J, Bertagna X, Grossman AB, Nieman LK. Cushing’s syndrome. Lancet. 2006;367(9522):1605–17. 2. Pivonello R, De Martino MC, De Leo M, Simeoli C, Colao A. Cushing’s disease: the burden of illness. Endocrine. 2017;56(1):10–8. 3. Whelan TB, Schteingart DE, Starkman MN, Smith A. Neuropsychological deficits in Cushing’s syndrome. J Nerv Ment Dis. 1980;168(12):753–7. 4. Forget H, Lacroix A, Somma M, Cohen H. Cognitive decline in patients with Cushing’s syndrome. J Int Neuropsychol Soc. 2000;6(1):20–9. 5. Starkman MN, Giordani B, Berent S, Schork MA, Schteingart DE. Elevated cortisol levels in Cushing’s disease are associated with cognitive decrements. Psychosom Med. 2001;63(6):985–93. 6. Tiemensma J, Kokshoorn NE, Biermasz NR, Keijser B-JSA, Wassenaar MJE, Middelkoop HAM, et al. Subtle cognitive impairments in patients with long-term cure of Cushing’s disease. J Clin Endocrinol Metab. 2010;95(6):2699–714. 7. Pivonello R, Simeoli C, De Martino MC, Cozzolino A, De Leo M, Iacuaniello D, et al. Neuropsychiatric disorders in Cushing’s syndrome. Front Neurosci. 2015;9:129. 8. Pires P, Santos A, Vives-Gilabert Y, Webb SM, Sainz-Ruiz A, Resmini E, et al. White matter involvement on DTI-MRI in Cushing’s syndrome relates to mood disturbances and processing speed: a case-control study. Pituitary. 2017;20(3):340–8. 9. Santos A, Resmini E, Pascual JC, Crespo I, Webb SM. Psychiatric symptoms in patients with Cushing’s syndrome: prevalence, diagnosis and management. Drugs. 2017;77(8):829–42. 10. Valassi E, Crespo I, Keevil BG, Aulinas A, Urgell E, Santos A, et al. Affective alterations in patients with Cushing’s syndrome in remission are associated with decreased BDNF and cortisone levels. Eur J Endocrinol. 2017;176(2):221–31. 11. Frimodt-Møller KE, Møllegaard Jepsen JR, Feldt-Rasmussen U, Krogh J. Hippocampal volume, cognitive functions, depression, anxiety, and quality of life in patients with Cushing syndrome. J Clin Endocrinol Metab. 2019;104(10):4563–77. 12. Kumar N, Jarial KDS, Bhansali A, Nehra R, Vyas S, Walia R. Neurocognitive functions and brain volume in patients with endogenous cushing’s syndrome before and after curative surgery. Indian J Endocrinol Metab. 2020;24(5):396–401. 13. Lin TY, Hanna J, Ishak WW. Psychiatric symptoms in Cushing’s syndrome: a systematic review. Innov Clin Neurosci. 2020;17(1–3):30–5. 14. Na S, Fernandes MA, Ioachimescu AG, Penna S. Neuropsychological and emotional functioning in patients with Cushing’s syndrome. Behav Neurol. 2020;2020:1–10. 15. Starkman MN, Giordani B, Gebarski SS, Berent S, Schork MA, Schteingart DE. Decrease in cortisol reverses human hippocampal atrophy following treatment of Cushing’s disease. Biol Psychiatry. 1999;46(12):1595–602. 16. Andela CD, van der Werff SJ, Pannekoek JN, van den Berg SM, Meijer OC, van Buchem MA, et al. Smaller grey matter volumes in the anterior cingulate cortex and greater cerebellar volumes in patients with long-term remission of Cushing’s disease: a case–control study. Eur J Endocrinol. 2013;169(6):811–9. 17. Crespo I, Esther G-M, Santos A, Valassi E, Yolanda V-G, De Juan-Delago M, et al. Impaired decision-making and selective cortical frontal thinning in Cushing’s syndrome. Clin Endocrinol. 2014;81(6):826–33. 18. Andela CD, van Haalen FM, Ragnarsson O, Papakokkinou E, Johannsson G, Santos A, et al. Mechanisms in endocrinology: cushing’s syndrome causes irreversible effects on the human brain: a systematic review of structural and functional magnetic resonance imaging studies. Eur J Endocrinol. 2015;173(1):R1–4. 19. Burkhardt T, Lüdecke D, Spies L, Wittmann L, Westphal M, Flitsch J. Hippocampal and cerebellar atrophy in patients with Cushing’s disease. Neurosurg Focus. 2015;39(5):E5–7. 20. Jiang H, Ren J, He NY, Liu C, Sun YH, Jian FF, et al. Volumetric magnetic resonance imaging analysis in patients with short-term remission of Cushing’s disease. Clin Endocrinol. 2017;87(4):367–74. 21. Bauduin SEEC, van der Wee NJA, van der Werff SJA. Structural brain abnormalities in Cushing’s syndrome. Curr Opin Endocrinol Diabetes Obes. 2018;25(4):285–9. 22. Jiang H, Liu C, Pan S-J, Ren J, He N-Y, Sun Y-H, et al. Reversible and the irreversible structural alterations on brain after resolution of hypercortisolism in Cushing’s disease. Steroids. 2019;151:108457. 23. Bauduin SEEC, Pal Z, Pereira AM, Meijer OC, Giltay EJ, Wee NJA, et al. Cortical thickness abnormalities in long-term remitted Cushing’s disease. Transl Psychiatry. 2020;10(1):239. 24. Hou B, Gao L, Shi L, Luo Y, Guo X, Young GS, et al. Reversibility of impaired brain structures after transsphenoidal surgery in Cushing’s disease: a longitudinal study based on an artificial intelligence-assisted tool. J Neurosurg. 2020;134(2):1–10. 25. van der Werff SJ, Andela CD, Nienke Pannekoek J, Meijer OC, van Buchem MA, Rombouts SA, et al. Widespread reductions of white matter integrity in patients with long-term remission of Cushing’s disease. Neuroimage Clin. 2014;4:659–67. 26. Pires P, Santos A, Vives-Gilabert Y, Webb S, Sainz-Ruiz A, Resmini E, et al. White matter alterations in the brains of patients with active, remitted, and cured Cushing syndrome: a DTI study. Am J Neuroradiol. 2015;36(6):1043–8. 27. Jiang H, He N-Y, Sun Y-H, Jian F-F, Bian L-G, Shen J-K, et al. Altered gray and white matter microstructure in Cushing’s disease: a diffusional kurtosis imaging study. Brain Res. 2017;1665:80–7. 28. Khiat A, Bard C, Lacroix A, Boulanger Y. Recovery of the brain choline level in treated Cushing’s patients as monitored by proton magnetic resonance spectroscopy. Brain Res. 2000;862(1–2):301–7. 29. Resmini E, Santos A, Gómez-Anson B, López-Mourelo O, Pires P, Vives-Gilabert Y, et al. Hippocampal dysfunction in cured Cushing’s syndrome patients, detected by 1H‐MR‐spectroscopy. Clin Endocrinol. 2013;79(5):700–7. 30. Crespo I, Santos A, Gómez-Ansón B, López-Mourelo O, Pires P, Vives-Gilabert Y, et al. Brain metabolite abnormalities in ventromedial prefrontal cortex are related to duration of hypercortisolism and anxiety in patients with Cushing’s syndrome. Endocrine. 2016;53(3):848–56. 31. Liu S, Wang Y, Xu K, Ping F, Li F, Wang R, et al. Voxel-based comparison of brain glucose metabolism between patients with Cushing’s disease and healthy subjects. Neuroimage Clin. 2018;17:354–8. 32. Cheng H, Gao L, Hou B, Feng F, Guo X, Wang Z, et al. Reversibility of cerebral blood flow in patients with Cushing’s disease after surgery treatment. Metabolism. 2020;104:154050. 33. Gao L, Liu L, Shi L, Luo Y, Wang Z, Guo X, et al. Dynamic changes of views on the brain changes of Cushing’s syndrome using different computer-assisted tool. Rev Endocr Metab Disord. 2020;21(1):185–200. 34. Piasecka M, Papakokkinou E, Valassi E, Santos A, Webb SM, de Vries F, et al. Psychiatric and neurocognitive consequences of endogenous hypercortisolism. J Intern Med. 2020;288(2):168–82. 35. Kelly DF. Transsphenoidal surgery for Cushing’s disease: a review of success rates, remission predictors, management of failed surgery, and Nelson’s Syndrome. Neurosurg Focus. 2007;23(3):E5. 36. Theodoropoulou M, Reincke M. Tumor-directed therapeutic targets in Cushing disease. J Clin Endocrinol Metab. 2019;104(3):925–33. 37. Maheu FS, Mazzone L, Merke DP, Keil MF, Stratakis CA, Pine DS, et al. Altered amygdala and hippocampus function in adolescents with hypercortisolemia: a functional magnetic resonance imaging study of Cushing syndrome. Dev Psychopathol. 2008;20(4):1177–89. 38. Langenecker SA, Weisenbach SL, Giordani B, Briceño EM, Guidotti Breting LM, Schallmo MP, et al. Impact of chronic hypercortisolemia on affective processing. Neuropharmacology. 2012;62(1):217–25. 39. Bas-Hoogendam JM, Andela CD, van der Werff SJA, Pannekoek JN, van Steenbergen H, Meijer OC, et al. Altered neural processing of emotional faces in remitted Cushing's disease. Psychoneuroendocrinology. 2015;59:134–46. 40. Van Der Werff SJ, Pannekoek JN, Andela CD, Meijer OC, Van Buchem MA, Rombouts SA, et al. Resting-state functional connectivity in patients with long-term remission of Cushing’s disease. Neuropsychopharmacology. 2015;40(8):1888–98. 41. Ragnarsson O, Stomby A, Dahlqvist P, Evang JA, Ryberg M, Olsson T, et al. Decreased prefrontal functional brain response during memory testing in women with Cushing’s syndrome in remission. Psychoneuroendocrinology. 2017;82:117–25. 42. Stomby A, Salami A, Dahlqvist P, Evang JA, Ryberg M, Bollerslev J, et al. Elevated resting-state connectivity in the medial temporal lobe and the prefrontal cortex among patients with Cushing’s syndrome in remission. Eur J Endocrinol. 2019;180(5):329–38. 43. Zung WW. A rating instrument for anxiety disorders. Psychosomatics. 1971;12(6):371–9. 44. Kim J-H, Lee J-M, Jo HJ, Kim SH, Lee JH, Kim ST, et al. Defining functional SMA and pre-SMA subregions in human MFC using resting state fMRI: functional connectivity-based parcellation method. NeuroImage. 2010;49(3):2375–86. 45. Power JD, Barnes KA, Snyder AZ, Schlaggar BL, Petersen SE. Spurious but systematic correlations in functional connectivity MRI networks arise from subject motion. NeuroImage. 2012;59(3):2142–54. 46. Nieman LK, Biller BM, Findling JW, Murad MH, Newell-Price J, Savage MO, et al. Treatment of Cushing’s syndrome: an endocrine society clinical practice guideline. J Clin Endocrinol Metab. 2015;100(8):2807–31. 47. Du Y, Fan Y. Group information guided ICA for fMRI data analysis. NeuroImage. 2013;69:157–97. 48. Fan Y, Liu Y, Wu H, Hao Y, Liu H, Liu Z, et al. Discriminant analysis of functional connectivity patterns on Grassmann manifold. NeuroImage. 2011;56(4):2058–67. 49. Li P, Jing RX, Zhao RJ, Ding ZB, Shi L, Sun HQ, et al. Electroconvulsive therapy-induced brain functional connectivity predicts therapeutic efficacy in patients with schizophrenia: a multivariate pattern recognition study. NPJ Schizophr. 2017;3(1):21–9. 50. Forget H, Lacroix A, Bourdeau I, Cohen H. Long-term cognitive effects of glucocorticoid excess in Cushing’s syndrome. Psychoneuroendocrinology. 2016;65:26–33. 51. Mauri M, Sinforiani E, Bono G, Vignati F, Berselli M, Attanasio R, et al. Memory impairment in Cushing’s disease. Acta Neurol Scand. 1993;87(1):52–5. 52. Jiang H, He NY, Sun YH, Jian FF, Bian LG, Shen JK, et al. Altered spontaneous brain activity in Cushing’s disease: a resting-state functional MRI study. Clin Endocrinol. 2017;86(3):367–76. 53. Amaya JM, Viho EM, Sips HC, Lalai RA, Sahut-Barnola I, Dumontet T, et al. Gene expression changes in the brain of a Cushing’s syndrome mouse model. J Neuroendocrinol. 2022;34(4):e13125. 54. Bauduin SEEC, van der Pal Z, Pereira AM, Meijer OC, Giltay EJ, van der Wee NJA, et al. Cortical thickness abnormalities in long-term remitted Cushing’s disease. Transl Psychiatry. 2020;10(1):293. 55. Wang X, Zhou T, Wang P, Zhang L, Feng S, Meng X, et al. Dysregulation of resting-state functional connectivity in patients with Cushing’s disease. Neuroradiology. 2019;61(8):911–20. © 2023 The Author(s). Published by S. Karger AG, Basel Open Access License / Drug Dosage / Disclaimer This article is licensed under the Creative Commons Attribution-NonCommercial 4.0 International License (CC BY-NC). Usage and distribution for commercial purposes requires written permission. Drug Dosage: The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant flow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any changes in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug. Disclaimer: The statements, opinions and data contained in this publication are solely those of the individual authors and contributors and not of the publishers and the editor(s). The appearance of advertisements or/and product references in the publication is not a warranty, endorsement, or approval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to persons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements. This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License . From https://karger.com/nen/article/doi/10.1159/000534789/869375/Reversibility-of-Impaired-Large-Scale-Functional

Abstract Cushing’s syndrome is a condition leading to overproducing of cortisol by the adrenal glands. If the pituitary gland overproduces cortisol, it is called Cushing’s disease. Cushing’s syndrome and even Cushing’s disease during and after pregnancy are rare events. There is not enough literature and guidance for managing and treating these patients. The diagnosis of Cushing’s syndrome in pregnancy is often delayed because the symptoms overlap. We presented a thin 31-year-old woman, admitted 2 months after a normal-term delivery, with an atypical presentation of Cushing’s disease, unusual clinical features, and a challenging clinical course. She had no clinical discriminatory features of Cushing’s syndrome. Given that the patient only presented with psychosis and proximal myopathy and had an uncomplicated pregnancy, our case was considered unusual. The patients also had hyperpigmentation and severe muscle weakness which are among the less common presentations of Cushing’s syndrome. Our findings suggest that an early diagnosis of Cushing’s disease is important in pregnancy period for its prevalent fetal and maternal complications, and it should be treated early to optimize fetal and maternal outcomes as there is an increasing trend toward live births in treated participants. Introduction Cushing’s syndrome is a condition that originates from excessive production of glucocorticoids. The condition is most common in women of childbearing age and is characterized by altered distribution of the adipose tissue to the central and upper regions of the trunk (central obesity and buffalo hump), face (moon face), capillary wall integrity (easy bruising), hyperglycemia, hypertension, mental status changes and psychiatric symptoms, muscle weakness, signs associated with hyperandrogenism (acne and hirsutism), and violaceous striae among other signs. Hypercortisolism and hyperandrogenism suppress the production of the pituitary gonadotropins, which in turn leads to menstrual irregularities and infertility.1-3 Moreover, the main common cause of developing Cushing’s syndrome is the use of exogenic steroid.3 Cushing’s disease is a form of Cushing’s syndrome with overproduction of adrenocorticotropic hormone (ACTH) due to pituitary adenoma. The diagnosis is made using clinical features and paraclinical tests including urinary free cortisol (UFC), serum ACTH, dexamethasone suppression tests (DSTs), pituitary magnetic resonance imaging (MRI), and sometimes by inferior petrosal sinus sampling (IPSS).4 Although women with Cushing’s disease are less likely to become pregnant, timely diagnosis and appropriate management are especially important during possible pregnancy, preventing neonatal and maternal complications and death. The diagnosis is challenging due to the overlap of the disease symptoms with the changes associated with a normal pregnancy. Moreover, the hormonal milieu during pregnancy has recently been proposed as a potential trigger for Cushing’s disease in some cases; hence, the term “pregnancy-associated Cushing’s disease” has been used for the disease in the recent literature. In this study, we presented a thin 31-year-old woman who was referred to our clinic 2 months after a normal delivery, with an atypical presentation of Cushing’s disease, unusual clinical features, and a challenging clinical course. Case Presentation Our patient was a 31-year-old woman who presented 2 months after the delivery of her second child. She had a history of type 2 diabetes mellitus and hypertension in the past 2 years prior to her presentation. She had been admitted to another center following an episode of falling and muscle weakness. Two weeks later, she was admitted to our center with an impression of pulmonary thromboembolism due to tachypnea, tachycardia, and dyspnea. During follow-up, she was found to have leukocytosis, hyperglycemia (random blood sugar: 415 mg/d; normal level: up to 180 mg/dL) and hypokalemic metabolic alkalosis (PH: 7.5, HCO3 [bicarbonate]: 44.7 mEq/L, paO2 [partial pressure of oxygen]: 73 mm Hg, pCO2: 51.7 mm Hg, potassium: 2.7 mEq/L [normal range: 3.5-5.1 mEq/L]), which was refractory to the treatment; therefore, an endocrinology consultation was first requested. On physical examination, the patient was agitated, confused, and psychotic. Her vital signs were: blood pressure 155/100 mm Hg, heart rate: 130 bpm, and respiratory rate: 22 bpm, temperature: 39°C. As it has shown in Figure 1A, her face is not typical for moon face of Cushing’s syndrome, but facial hirsutism (Figure 1A) and generalized hyperpigmentation is obvious (Figure 1A-C). She was a thin lady and had a normal weight and distribution of adiposity (Body Mass Index [BMI] = 16.4 kg/m2; weight: 40 kg, and height: 156 cm). Aside from thinness of skin, she did not have the cutaneous features of Cushing’s syndrome (e.g. purpura, acne, and violaceous striae) and did not have supraclavicular and dorsocervical fat pad (buffalo hump), or plethora. In other words, she had no clinical discriminatory features of Cushing’s syndrome despite the high levels of cortisol, as confirmed by severely elevated UFC (5000 μg/24 h and 8000 μg/24 h; normal level: 4-40 μg/24 h). In addition, as will be mentioned later, the patient had axonal neuropathy which is a very rare finding in Cushing’s syndrome. Figure 1. Clinical finding of our case with Cushing’s disease. (A) Hirsutism, (B) muscle atrophy seen in proximal portion of lower limbs, and (C) hyperpigmentation specially on the skin of the abdominal region. OPEN IN VIEWER She had a markedly diminished proximal muscle force of 1 out of 5 across all extremities; the rest of the physical examinations revealed no significant abnormalities (Figure 1B). On the contrary, based on her muscle weakness, hirsutism, psychosis and hyperpigmentation and refractory hypokalemic alkalosis, hyperglycemia, and hypertension, Cushing’s syndrome was suspected; therefore, 24-hour UFC level was checked that the results showed a severely elevated urinary cortisol (5000 μg/24 h and 8000 μg/24 h; normal level: 4-40 μg/24 h). Serum ACTH level was also inappropriately elevated (45 pg/mL; normal range: 10-60 pg/mL). High-dose dexamethasone failed to suppress plasma cortisol level and 24-hour urine cortisol level. A subsequent pituitary MRI showed an 8-mm pituitary mass, making a diagnosis of Cushing’s disease more probable. Meanwhile, the patient was suffering from severe muscle weakness that did not improve after the correction of hypokalemia. Then, a neurology consultation was requested. The neurology team evaluated laboratory data as well as EMG (Electromyography) and NCV (Nerve Conduction Velocity) of the patient, and based on their findings, “axonal neuropathy” was diagnosed for her weakness; so they ruled out the other neuromuscular diseases. A 5-day course of intravenous immunoglobulin (IVIG) was started for her neuropathy; however, the treatment did not improve her symptoms and the patient developed fungal sepsis and septic shock. Therefore, she was processed with broad-spectrum antibiotics and antifungal agents and recovered from the infection. Mitotane was started for the patient before definitive surgical treatment to suppress hormonal production due to her poor general condition. Despite the 8-mm size of the pituitary mass which is likely to be a source of ACTH, our patient was underweight and showed the atypical clinical presentation of Cushing’s disease, making us suspect an ectopic source for the ACTH. Therefore, a Gallium dotatate scan was performed to find any probable ectopic sources; however, the results were unremarkable. The patient underwent Trans-Sphenoidal Surgery (TSS) to resect the pituitary adenoma because it was not possible to perform IPSS in our center. Finally, the patient’s condition including electrolyte imbalance, muscle weakness, blood pressure, and hyperglycemia started to improve significantly. The pathologist confirmed the diagnosis of a corticotropic adenoma. Nevertheless, the patient suddenly died while having her meal a week after her surgery; most likely due to a thromboembolic event causing a cardiac accident. Discussion Our patient was significantly different from other patients with Cushing’s disease because of her atypical phenotype. She was unexpectedly thin and had psychosis, hyperpigmentation, proximal myopathy, axonal neuropathy and no clinical discriminatory features of Cushing’s syndrome such as central adiposity, dorsocervical or supraclavicular fat pad, plethora or striae. She had also a history of type 2 diabetes and hypertension 2 years before her admission. The patient was diagnosed with Cushing’s later. From what was presented, the patient did not know she had Cushing’s until after her delivery and despite the highly elevated UFC, and she completed a normal-term delivery. Given that she only presented with psychosis and proximal myopathy, her pregnancy was considered unusual. Her clinical features such as hyperpigmentation and severe muscle weakness are among less common presentations.5 11β-hydroxysteroid dehydrogenase type 1 (11-βHSD1) is an enzyme responsible for converting cortisone (inactive glucocorticoid) into cortisol (active). It is speculated that this enzyme has a role in obesity (Figure 2).6,7 Figure 2. The enzymatic actions of 11β-hydroxysteroid dehydrogenase on its substrate interconverting inactive and active glucocorticoid. OPEN IN VIEWER In a case reported by Tomlinson, a 20-year-old female was diagnosed with Cushing’s disease despite not having the classical features of the disease. It has been suggested that the mechanism is a partial defect in 11β-HSD1 activity and concomitant increase in cortisol clearance rate. Thus, the patient did not have a classic phenotype; the defect in the conversion of cortisone to cortisol rises cortisol clearance and protects the patient from the effects of cortisol excess. This observation may help explain individual susceptibility to the side effects of glucocorticoids.6 Further studies of Tomlinson et al showed that a deficit in the function of (and not a mutation related to) 11β-HSD2 might have been responsible for the absence of typical Cushing’s symptoms. 11-HSD2 keeps safe the mineralocorticoid receptor from excess cortisol. Mutation in the HSD11B2 gene explains an inherited form of hypertension, apparent mineralocorticoid excess syndrome, in which Cushing’s disease results in cortisol-mediated mineralocorticoid excess affecting the kidney and leads to both hypokalemia and hypertension.8 It is frequent in Cushing’s syndrome that the patients usually have no mineralocorticoid hypertension; however, it is still proposed that a defect in 11β-HSD1 can be responsible for the presence of mineralocorticoid hypertension in a subgroup of patients. In fact, 11β-HSD1 is expressed in several tissues like the liver, kidneys, placenta, fatty tissues and gonads,9 meaning that this enzyme may potentially affect the results of cortisol excess in Cushing’s syndrome/disease. Abnormality in the function of this enzyme could explain the absence of the symptoms like central obesity, easy bruising, and typical striae during Cushing’s disease. Several factors affect the action of glucocorticoids. In this regard, the impact of the different types and levels of impairment in glucocorticoid receptors have been highlighted in some studies, as it can lead to different levels of response to glucocorticoids10 as well as a variety in the symptoms observed in Cushing’s disease. The predominant reaction of the NADP(H)-dependent enzyme 11-Tukey’s honestly significant difference (HSD)1 happens through the catalysis of the conversion of inactive cortisol into receptor-active cortisol. The reverse reaction is mediated through the unidirectional NAD-dependent 11-HSD type 2 (Figure 2).11 In another case reported by Ved V. Gossein, a 41-year-old female was evaluated for hirsutism and irregular menstrual cycles. Her BMI was 22.6 kg/m2. The patient had no signs or symptoms of overnight recurrent Cushing’s syndrome, the 48-hour DST failed to suppress cortisol levels, and 24-hour urinary cortisol levels were persistently elevated on multiple occasions. Adrenocorticotropic hormone levels were unreasonably normal, suggesting ACTH-dependent hypercortisolism. Despite these disorders, she had 2 children. Magnetic resonance imaging (MRI) of the pituitary did not show any abnormalities. Moreover, abdominal MRI did not show adrenal mass or enlargement. Genetic testing to determine glucocorticoid resistance syndrome showed no mutation.12 Primary generalized glucocorticoid resistance is a rare genetic disorder characterized by generalized or partial insensitivity of target tissues to glucocorticoids.13-17 There is a compensatory increase in hypothalamic-pituitary activity due to decreased sensitivity of peripheral tissues to glucocorticoids systems.13-17 Excessive ACTH secretion leads to high secretion of cortisol and mineralocorticoids and/or androgens. However, the clinical features of Cushing’s syndrome do not develop after resistance to the effects of cortisol. Generalized glucocorticoid resistance is a rare condition characterized by high cortisol levels but no scarring of Cushing’s syndrome.18 An important aspect of our case was her pregnancy. Our patient had a history of hypertension and diabetes type 2, 2 years before her presentation to our center that could be because of an undiagnosed Cushing’s disease. The patient’s pregnancy terminated 2 months prior the admission and she had a normal vaginal delivery. So, we suspect that she become pregnant while involved with the disease. Aside from focusing on how this can happen in a patient with such high levels of glucocorticoids, more attention should be paid to occurring pregnancy in the background of Cushing’s disease. In fact, up to 250 patients were reported, of which less than 100 were actively treated.19-22 Cushing’s disease is associated with serious complications in up to 70% of the cases coinciding with pregnancy.21 The most frequent maternal complications reported in the literature are hypertension and impaired glucose tolerance, followed by preeclampsia, osteoporosis, severe psychiatric complications, and maternal death (in about 2% of the cases). Prematurity and intrauterine growth retardation account for the most prevalent fetal complications. Stillbirth, intrauterine deaths, intrauterine hemorrhage, and hypoadrenalism have also been reported.23 Early diagnosis is especially challenging during pregnancy because of many clinical and biochemical shared features of the 2 conditions.23,24 These features include an increase in ACTH production, corticosteroid-binding globulin (CBG) 1 level, level of cortisol (urinary, plasma and free), hyperglycemia, weight gain, and an increased chance for occurrence of bruising, hypertension (mistaken with preeclampsia), gestational diabetes mellitus, weight gain, and mood swings.3 There are some suggestions proposed in the studies that help in screening and differentiation of Cushing’s from the normal and abnormal effects of pregnancy and Cushing’s disease from Cushing’s syndrome in suspected pregnant patients. Contrary to Cushing’s syndrome, the nocturnal minimum level of cortisol is preserved in pregnancy.23,25 There is not yet a diagnostic cut-off determined on mentioned level; however, a few studies elucidate the evaluation of hypercortisolemia in a pregnant patient.26-28 Urinary free cortisol, a measure that reflects the amount of free cortisol in circulation, normally increases during pregnancy, and it can increase up to 8 times the normal level with Cushing’s disease during the second and the third trimesters,23,29 which is a useful tool to evaluate cortisol levels in a suspected pregnant woman. Because the suppression of both UFC and plasma cortisol is decreased in pregnancy,23,30 a low-dose DST is not very helpful for screening Cushing’s disease in pregnant patients. However, a high-dose DST with a <80% cortisol suppression might only indicate Cushing’s disease.3,31 Thus, it helps differentiating between ectopic ACTH syndrome and Cushing’s disease.32 The use of high-dose DST can distinguish between adrenal and pituitary sources of CS in pregnancy. Owing to the limited evidence available and the lack of data on normal pregnancies, the use of corticotropin-releasing hormone (CRH), desmopressin, and high-dose DST in pregnancy is not recommended yet.33 More timely diagnosis as well as timely intervention may have saved the life of our patient. To differentiate between ectopic ACTH syndrome and Cushing’s disease, adrenal imaging should be considered. For higher plasma levels, combined employment of CRH stimulation test and an 8-mg DST can be helpful.3 Bilateral inferior petrosal sinus sampling (B-IPSS) might be needed when the findings are not in accordance with other results, but it is recommended to perform B-IPSS only if the noninvasive studies are inconclusive and only if there is enough expertise, experience, and technique for its performance.3 Although axonal neuropathy has been reported as a rare syndrome associated with paraneoplastic ectopic Cushing’s syndrome and exogenous Cushing’s syndrome, its association with Cushing’s disease has not been reported.5,32 Our patient had severe muscle weakness that we initially attributed it to myopathy and hypokalemia associated with Cushing’s syndrome. In our study, the diagnosis of axonal neuropathy was made based on electrophysiological studies by a neurology consultant and then IVIG was administered; however, the patient’s weakness did not improve after this treatment. The co-occurrence of Guillain-Barré syndrome which may also be classified as axonal neuropathy has also been reported in a pregnant woman with ectopic Cushing’s syndrome.34,35 Whether this finding is coincidental or the result of complex immune reactions driven by Cushing’s disease, or the direct effect of steroids, these results cannot be deduced from current data.36 Some data suggest that the fluctuations and inferior petrosal sinus sampling may trigger the flare of autoimmune processes, specifically when the cortisol levels start to decline during the course of Cushing’s syndrome.35,8 Also, due to COVID-19 pandemic affecting vital organs like kidney, paying attention to COVID-19 is suggested.37-40 Conclusions We presented a thin young female with psychosis, proximal myopathy, and axonal neuropathy with Cushing’s disease who had a recent pregnancy that was terminated without any fetal or maternal complications despite the repeated elevated serum cortisol and 24-hour UFC; therefore, we suggest that she might have glucocorticoid resistance. Glucocorticoid resistance is a rare disease in which the majority, but not all, of patients have a genetic mutation in the hGR-NR3C1 gene. As we did not perform genetic testing for our patient, the data are lacking. Another clue to the absence of the classic Cushing’s disease phenotype in our case is the role of isoenzymes of 11-HSD1 and 11-HSD2. Other mechanisms, such as the defect somewhere in the glucocorticoid pathway of action such as a decreased number of receptors, a reduction in ligand affinity, or a postreceptor defect, play an important role in nonclassical clinical manifestations of Cushing’s syndrome. Acknowledgments The authors thank the patient for allowing us to publish this case report. The authors show their gratitude to the of the staff of the Rasool Akram Medical Complex Clinical Research Development Center (RCRDC) specially Mrs. Farahnaz Nikkhah for its technical and editorial assists. Ethics Approval Our institution does not require ethical approval for reporting individual cases or case series. Informed Consent Written informed consent was obtained from the patient and for her anonymized information to be published in this article. Declaration of Conflicting Interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. Funding The author(s) received no financial support for the research, authorship, and/or publication of this article. References 1. Guilhaume B, Sanson ML, Billaud L, Bertagna X, Laudat MH, Luton JP. Cushing’s syndrome and pregnancy: aetiologies and prognosis in twenty-two patients. Eur J Med. 1992; 1(2):83-89. GO TO REFERENCE PubMed Google Scholar 2. Lin W, Huang HB, Wen JP, et al. Approach to Cushing’s syndrome in pregnancy: two cases of Cushing’s syndrome in pregnancy and a review of the literature. Ann Transl Med. 2019; 7(18):490. Crossref PubMed Google Scholar 3. Vilar L, Freitas MdC, Lima LHC, Lyra R, Kater CE. Cushing’s syndrome in pregnancy: an overview. Arq Bras Endocrinol Metabol. 2007;51(8):1293-1302. Crossref PubMed Google Scholar 4. Pecori Giraldi F, Cavallo LM, P, et al. The role of inferior petrosal sinus sampling in ACTH-dependent Cushing’s syndrome: review and joint opinion statement by members of the Italian Society for Endocrinology, Italian Society for Neurosurgery, and Italian Society for Neuroradiology. Neurosurg Focus. 2015;38(2):E5. GO TO REFERENCE PubMed Google Scholar 5. Molina Garrido MJ, Guillén Ponce C, Maciá Escalante S, Pons Sanz V, Carrato Mena A. Cushing’s paraneoplastic syndrome as first manifestation of an adenocarcinoma of unknown origin. Clin Transl Oncol. 2006;8(8):621-623. Crossref PubMed Google Scholar 6. Tomlinson JW, Draper N, Mackie J, et al. Absence of Cushingoid phenotype in a patient with Cushing’s disease due to defective cortisone to cortisol conversion. J Clin Endocrinol Metab. 2002;87(1):57-62. PubMed Google Scholar 7. Kobayashi T, Matsumoto T, Kamata K. IGF-I-induced enhancement of contractile response in organ-cultured aortae from diabetic rats is mediated by sustained thromboxane A2 release from endothelial cells. J Endocrinol. 2005;186(2): 367-376. GO TO REFERENCE Crossref PubMed Google Scholar 8. Stewart PM. Tissue-specific Cushing’s syndrome, 11β-hydroxysteroid dehydrogenases and the redefinition of corticosteroid hormone action. Eur J Endocrinol. 2003;149:163-168. Crossref PubMed Google Scholar 9. Ricketts ML, Verhaeg JM, Bujalska I, et al. Immunohistochemical localization of type 1 11β-hydroxysteroid dehydrogenase in human tissues. J Clinl Endocrinol Metabol. 1998;83:1325-1335. GO TO REFERENCE PubMed ISI Google Scholar 10. Huizenga NA, Koper JW, De Lange P, et al. A polymorphism in the glucocorticoid receptor gene may be associated with and increased sensitivity to glucocorticoids in vivo. J Clin Endocrinol Metab. 1998;83(1):144-151. GO TO REFERENCE PubMed Google Scholar 11. Hintzpeter J, Stapelfeld C, Loerz C, Martin HJ, Maser E. Green tea and one of its constituents, Epigallocatechine-3-gallate, are potent inhibitors of human 11β-hydroxysteroid dehydrogenase type 1. PLoS ONE. 2014;9(1):e84468. GO TO REFERENCE Crossref PubMed Google Scholar 12. Gossain VV, El-Rifai M, Krishnan P, Bhavsar B. Cushing’s syndrome with no clinical stigmata—a variant of glucocorticoid resistance syndrome. Clin Diabetes Endocrinol. 2018;4:23-25. GO TO REFERENCE Crossref PubMed Google Scholar 13. Charmandari E, Kino T, Ichijo T, Chrousos GP. Generalized glucocorticoid resistance: clinical aspects, molecular mechanisms, and implications of a rare genetic disorder. J Clin Endocrinol Metab. 2008;93(5):1563-1572. Crossref PubMed Google Scholar 14. Cidlowski JA, Malchoff CD, Malchoff DM. Glucocorticoid receptors, their mechanism of action, and glucocorticoid resistance. In: Jameson JL, De Groot LJ, eds. Endocrinology: Adult and Pediatric. Saunders; 2016:1717-1726. Google Scholar 15. Charmandari E, Kino T. Chrousos syndrome: a seminal report, a phylogenetic enigma and the clinical implications of glucocorticoid signaling changes. Eur J Clin Investig. 2010;40: 932-942. Crossref PubMed Google Scholar 16. Nicolaides NC, Charmandari E. Chrousos syndrome: from molecular pathogenesis to therapeutic management. Eur J Clin Invest. 2015;45(5):504-514. Crossref PubMed Google Scholar 17. Nicolaides N, Lamprokostopoulou A, Sertedaki A, Charmandari E. Recent advances in the molecular mechanisms causing primary generalized glucocorticoid resistance. Hormones. 2016;15(1): 23-34. Crossref PubMed Google Scholar 18. Huizenga NATM De Lange P, Koper JW, et al. Five patients with biochemical and/or clinical generalized glucocorticoid resistance without alterations in the glucocorticoid receptor gene. J Clin Endocrinol Metab. 2000;85:2076-2081. GO TO REFERENCE PubMed Google Scholar 19. Luger A, Broersen LHA, Biermasz NR, et al. ESE clinical practice guideline on functioning and nonfunctioning pituitary adenomas in pregnancy. Eur J Endocrinol. 2021;185: G1-G33. GO TO REFERENCE Crossref PubMed Google Scholar 20. Sridharan K, Sahoo J, Palui R, et al. Diagnosis and treatment outcomes of Cushing’s disease during pregnancy. Pituitary. 2021;24(5):670-680. Crossref PubMed Google Scholar 21. Caimari F, Valassi E, Garbayo P, et al. Cushing’s syndrome and pregnancy outcomes: a systematic review of published cases. Endocrine. 2017;55(2):555-563. GO TO REFERENCE Crossref PubMed Google Scholar 22. Lindsay JR, Jonklaas J, Oldfield EH, Nieman LK. Cushing’s syndrome during pregnancy: personal experience and review of the literature. J Clin Endocrinol Metab. 2005;90(5):3077-3083. GO TO REFERENCE Crossref PubMed Google Scholar 23. Lindsay JR, Nieman LK. The hypothalamic-pituitary-adrenal axis in pregnancy: challenges in disease detection and treatment. Endocr Rev. 2005;26(6):775-799. Crossref PubMed Google Scholar 24. Buescher MA, McClamrock HD, Adashi EY. Cushing syndrome in pregnancy. Obstetr Gynecol. 1992;79:130-137. GO TO REFERENCE PubMed Google Scholar 25. Carr BR, Parker CR Jr, Madden JD, et al. Maternal plasma adrenocorticotropin and cortisol relationships throughout human pregnancy. Am J Obstetr Gynecol. 1981;139:416-422. GO TO REFERENCE Crossref PubMed ISI Google Scholar 26. Mellor A, Harvey RD, Pobereskin LH, Sneyd JR. Cushing’s disease treated by trans-sphenoidal selective adenomectomy in mid-pregnancy. Br J Anaesth. 1998;80(6):850-852. GO TO REFERENCE Crossref PubMed Google Scholar 27. Doshi S, Bhat A, Lim K. Cushing’s syndrome in pregnancy. J Obstetr Gynaecol. 2003;23:568-569. Crossref Google Scholar 28. Wood PJ, Barth JH, Freedman DB, Perry L, Sheridan B. Evidence for the low dose dexamethasone suppression test to screen for Cushing’s syndrome—recommendations for a protocol for biochemistry laboratories. Ann Clin Biochem. 1997;34(pt 3):222-229. GO TO REFERENCE Crossref PubMed Google Scholar 29. Lindsay JR, Jonklaas J, Oldfield EH, Nieman LK. Cushing’s syndrome during pregnancy: personal experience and review of the literature. J Clin Endocrinol Metab. 2005;90(5): 3077-3083. GO TO REFERENCE Crossref PubMed Google Scholar 30. Wallace C, Toth EL, Lewanczuk RZ, Siminoski K. Pregnancy-induced Cushing’s syndrome in multiple pregnancies. J Clin Endocrinol Metab. 1996;81(1):15-21. GO TO REFERENCE PubMed Google Scholar 31. Invitti C, Pecori Giraldi F, de Martin M, Cavagnini F. Diagnosis and management of Cushing’s syndrome: results of an Italian multicentre study. Study Group of the Italian Society of Endocrinology on the Pathophysiology of the Hypothalamic-Pituitary-Adrenal Axis. J Clin Endocrinol Metab. 1999;84(2):440-448. GO TO REFERENCE PubMed Google Scholar 32. Vilar L, Naves LA, Freitas MdC, et al. Endogenous Cushing’s syndrome: clinical and laboratorial features in 73 cases. Arq Bras Endocrinol Metabol. 2007;51(4):566-574. Crossref PubMed Google Scholar 33. Hamblin R, Coulden A, Fountas A, Karavitaki N. The diagnosis and management of Cushing’s syndrome in pregnancy. J Neuroendocrinol. 2022;34(8):e13118. GO TO REFERENCE Crossref PubMed Google Scholar 34. Bressler R, Johnson CT. Cushing’s syndrome and the Guillain-Barré syndrome. Ann Intern Med. 1959;50:1298-1303. GO TO REFERENCE Crossref PubMed Google Scholar 35. Moeindarbary S, Abbasi dalooei M, Ghahremani S, et al. Guillain-Barré syndrome following Cushing’s syndrome in a pregnant woman: a case report. Int J Pediatr. 2019;7:10651-10657. Google Scholar 36. Hasenmajer V, Sbardella E, Sciarra F, Minnetti M, Isidori AM, Venneri MA. The immune system in Cushing’s syndrome. Trends Endocrinol Metab. 2020;31(9):655-669. GO TO REFERENCE Crossref PubMed Google Scholar 37. Besharat S, Alamda NM, Dadashzadeh N, et al. Clinical and demographic characteristics of patients with COVID-19 who died in Modarres Hospital. Open Access Maced J Med Sci. 2020;8:144-149. GO TO REFERENCE Crossref Google Scholar 38. Lotfi B, Farshid S, Dadashzadeh N, Valizadeh R, Rahimi MM. Is Coronavirus Disease 2019 (COVID-19) associated with renal involvement? A review of century infection. Jundishapur J Microbiol. 2020;13:e102899. Crossref Google Scholar 39. Dadashzadeh N, Farshid S, Valizadeh R, Nanbakhsh M, Rahimi MM. Acute respiratory distress syndrome in COVId-19 disease. Immunopathol Persa. 2020;6:e16. Crossref Google Scholar 40. Petramala L, Olmati F, Conforti MG, et al. Autoimmune diseases in patients with Cushing’s syndrome after resolution of hypercortisolism: case reports and literature review. Int J Endocrinol. 2018;2018:1464967. GO TO REFERENCE Crossref PubMed Google Scholar Related content Similar articles: Open Access Ectopic ACTH Production Leading to Diagnosis of Underlying Medullary Thyroid Carcinoma Show details Open Access Muscle Weakness: A Misleading Presentation in Children With Distinctive Syndromic Entities (Clinical Case Reports) Show details Open Access A Pitfall of Falsely Elevated ACTH: A Case Report and Literature Review Show details View more Sage recommends: SAGE Knowledge Entry Hypothalamic-Pituitary-Adrenal Axis Show details SAGE Knowledge Entry Congenital Adrenal Hyperplasia Show details SAGE Knowledge Entry Guillain-Barré Syndrome Show details View more From https://journals.sagepub.com/doi/full/10.1177/23247096231204732

Abstract Corticotroph macroadenomas are rare but difficult to manage intracranial neoplasms. Mutations in the two Cushing’s disease mutational hotspots USP8 and USP48 are less frequent in corticotroph macroadenomas and invasive tumors. There is evidence that TP53 mutations are not as rare as previously thought in these tumors. The aim of this study was to determine the prevalence of TP53 mutations in corticotroph tumors, with emphasis on macroadenomas, and their possible association with clinical and tumor characteristics. To this end, the entire TP53 coding region was sequenced in 86 functional corticotroph tumors (61 USP8 wild type; 66 macroadenomas) and the clinical characteristics of patients with TP53 mutant tumors were compared with TP53/USP8 wild type and USP8 mutant tumors. We found pathogenic TP53 variants in 9 corticotroph tumors (all macroadenomas and USP8 wild type). TP53 mutant tumors represented 14% of all functional corticotroph macroadenomas and 24% of all invasive tumors, were significantly larger and invasive, and had higher Ki67 indices and Knosp grades compared to wild type tumors. Patients with TP53 mutant tumors had undergone more therapeutic interventions, including radiation and bilateral adrenalectomy. In conclusion, pathogenic TP53 variants are more frequent than expected, representing a relevant amount of functional corticotroph macroadenomas and invasive tumors. TP53 mutations associated with more aggressive tumor features and difficult to manage disease. Introduction Pituitary neuroendocrine tumors are the second most common intracranial neoplasm [1]. They are usually benign, but when aggressive they may be particularly difficult to manage, accompanied by high comorbidity and increased mortality [2]. Corticotroph tumors constitute 6–10% of all pituitary tumors, but they represent up to 45% of aggressive pituitary tumors and pituitary carcinomas [2]. Functional corticotroph tumors cause Cushing’s disease (CD), a debilitating condition accompanied by increased morbidity and mortality due to glucocorticoid excess [3]. Pituitary surgery is the first line treatment, but recurrence is observed in 15–20% of cases of whom most are macroadenomas (with a size of ≥ 10 mm) [4]. Treatment options include repeated pituitary surgery, radiation therapy, medical treatment and bilateral adrenalectomy (BADX) [3]. With respect to the latter, corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome (CTP-BADX/NS) is a frequent severe complication and may present with aggressive tumor behavior [5,6,7]. Corticotroph tumors (including CTP-BADX/NS) carry recurrent somatic mutations in the USP8 gene in ~ 40–60% of cases [8,9,10,11,12,13]. These USP8 mutant tumors are usually found in female patients and are generally less invasive [8,9,10,11]. Additional genetic studies identified a second mutational hotspot in the USP48 gene, but no other driver mutations [14,15,16,17,18]. Focusing on USP8 wild type corticotroph tumors, we recently discovered TP53 mutations in 6 out of 18 cases (33%) [17]. Subsequent reports documented TP53 mutations in small series of mainly aggressive corticotroph tumors and carcinomas [19, 20]. TP53 is the most commonly mutated gene in malignant neoplasms [21, 22], including brain and neuroendocrine tumors [23, 24]. Until our previous report [17], TP53 mutations were only described in isolated cases of aggressive pituitary tumors and carcinomas, and were therefore considered very rare events [8, 16, 25,26,27,28]. A link between TP53 mutations and an aggressive corticotroph tumor phenotype has been hypothesized, but the heterogeneity and small size of the studies reported did not support significant clinical associations [17, 19]. To address this, we determined the prevalence of TP53 variants in a cohort of 86 patients with functional corticotroph tumors, including 61 with USP8 wild type tumors, and studied the associations between TP53 mutational status and clinical features. Methods Patients and samples We analyzed tumor samples of 86 adult patients: 61 USP8 wild type and 25 USP8 mutant. Sixty-six patients (46 females, 20 males) were diagnosed with CD between 1994 and 2020 in Germany (Hamburg, Munich, Erlangen, and Tübingen) and Luxembourg. Twenty additional patients (16 females, 4 males) were diagnosed with CTP-BADX/NS, operated and followed up in 7 different international centers (Nijmegen, Munich, Erlangen, Hamburg, Paris, Rio de Janeiro, and Würzburg). Twenty-three out of 86 samples were collected prospectively between 2018 and 2021, and 63 were retrospective cases (of which 42 were investigated in the context of USP8 and USP48 screenings and published elsewhere) [9, 12, 13, 17]. Seventy-one tumors were fresh frozen and 15 were formalin fixed paraffin embedded. Paired blood was available for 12 cases. The median follow-up time after initial diagnosis was 44 months (range 2–384 months). Endogenous Cushing’s syndrome was diagnosed according to typical clinical signs and symptoms and established biochemical procedures suggesting glucocorticoid excess. Clinical features included central obesity, moon face, buffalo hump, muscle weakness, easy bruising, striae, acne, low-impact bone fractures, mood changes, irregular menstruation, infertility and impotency. Biochemical diagnosis was based on increased 24 h urinary free cortisol (UFC) and late-night salivary cortisol levels, and lack of serum cortisol suppression after low-dose dexamethasone test. A pituitary ACTH source was confirmed by > 2.2 pmol/l (10 pg/ml) basal plasma ACTH, > 50% suppression of serum cortisol during an 8 mg dexamethasone test, and ACTH and cortisol response to corticotrophin releasing hormone stimulation. The clinical and pathological features of our study cohort are summarized in Additional file 1: Supplementary Table 1. All patients underwent pituitary surgery. The presence of an ACTH-producing pituitary tumor was confirmed histologically after surgical resection. Biochemical remission after surgery was defined as postoperative 24 h-UFC levels below or within the normal range, or serum cortisol levels < 5 µg/dl after low-dose (1 or 2 mg) dexamethasone suppression test. Tumor control was achieved when there was no evidence of regrowth or disease recurrence. Tumor invasion was defined as radiological or intraoperative evidence of tumor within the sphenoid and/or cavernous sinuses [29]. CTP-BADX/NS was defined as an expanding pituitary tumor after bilateral adrenalectomy (BADX) following expert consensus recommendations [5]. DNA extraction, TP53 amplification and sequencing Genomic DNA was extracted using the Maxwell Tissue DNA Kit (Promega), Maxwell Blood DNA kit (Promega) or the FFPE DNA mini kit (Qiagen), depending on the type of sample, as described previously [9, 12]. The entire coding sequence of TP53 (including exons 9β and 9γ) as well as noncoding regions adjacent to each exon were amplified using the GoTaq DNA polymerase (Promega) and specific primers (Additional file 1: Supplementary Table 2). Amplification of USP8 hotspot region and Sanger sequencing were performed as described previously [9, 12]. Chromatograms were analyzed using the Mutation Surveyor v4.0.9 (Soft Genetics). Samples were examined for TP53 coding and splicing variants. Variant position and pathogenicity was investigated in ENSEMBL (www.ensembl.org), the UCSC Genome Browser (http://genome-euro.ucsc.edu), the IARC TP53 database (https://p53.iarc.fr/TP53GeneVariations.aspx), the Catalogue Of Somatic Mutations in Cancer (COSMIC; https://cancer.sanger.ac.uk/cosmic), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), PHANTM (http://mutantp53.broadinstitute.org/), the Human Splicing Finder (HSF; http://www.umd.be/HSF3/) and VarSEAK splicing predictor (https://varseak.bio/). Variant frequencies on the general population were obtained from the Allele Frequency Aggregator (ALFA) project [30], the Genome Aggregation Database (gnomAD) [31] and the International Genome Sample Resource 1000Genome project [32]. Throughout the text, variants refer to NC_000017.11 (genomic DNA), ENST00000269305.9 (coding DNA) and ENSP00000269305.4 (protein), following the Human Genome Variation Society (HGVS) standard nomenclature system. Statistical analysis Statistical analysis was performed with the software package SPSS v24 (IBM). We used t-test or one-way ANOVA to analyze the association of TP53 variants with age, body mass index; Mann–Whitney U and Kruskal–Wallis to test non-parametric variables, such as tumor size, hormone levels, Ki67 index and p53 score. We corrected the analysis for multiple comparisons with the Bonferroni test. Categorical variables were analyzed using a chi-square test or Fisher exact test when needed. Survival analysis was performed using Kaplan–Meier curves with log-rank tests, and multivariate Cox regression. An exact, two-tailed significance level of P < 0.05 was considered to be statistically significant. Results Analysis of TP53 nucleotide variants We analyzed all TP53 coding exons (including exons 9β and 9γ) and adjacent intronic noncoding sequences in 61 USP8 wild type tumors (49 CD and 12 CTP-BADX/NS). Of these, 13 were microadenomas (< 10 mm) and 48 macroadenomas (≥ 10 mm) at the time of the current operation. A separate group of 25 USP8 mutant tumors (17 CD and 8 CTP-BADX/NS) that were mainly macroadenomas (n = 19) was used for multiple comparison. We found 59 variants in our cohort: 30 exclusively in USP8 wild type, 21 in USP8 mutant, and 8 in wild type and mutant tumors regardless of USP8 mutational status. No indels in the coding region of TP53 were detected. In addition, we did not find any genetic variant affecting TP53 splicing. Nine out of 30 variants found in USP8 wild type tumors were either reported in the COSMIC database as pathogenic or absent from the common variant databases (1000Genomes, gnomAD, ALPHA) or had allele frequency < 0.0001. They were all described in cancer series: 5 as pathogenic or likely pathogenic in ClinVar, 2 as variants of uncertain significance (VUS) and 2 were not described in ClinVar (Table 1). All variants are reported to alter protein function and show clear loss of transactivation activity in a yeast based assay (Table 1) [33]. Table 1 Functionally relevant TP53 variants found in 9/86 corticotroph tumors Full size table Seven variants target amino acids within the DNA-binding domain, essential for p53 activity, disrupting S2’ and S7 β-sheets or the L3 loop spatial conformation. The other two [c.1009C > G (p.Arg337Gly) and c.1031 T > C (p.Leu344Pro)] locate in the tetramerization domain and keep p53 protein as monomer impairing its transactivation activity [34]. From the 9 variants, 8 affect highly conserved p53 residues, while in c.1031 T > C (p.Met133Lys) the methionine alternates with leucine or valine among species. This variant alters protein folding, probably reducing DNA affinity [35], while the substitution of a methionine that acts as an alternative start codon abolishes the transcription of isoforms ∆133p53α, ∆133p53β and ∆133p53γ. The 9 variants were detected in nine cases (henceforth referred to as TP53 mutant; Table 1). Two tumors from unrelated patients (#6 and #7) carried the same variant c.818G > A (p.Arg273His), while one tumor (#4) carried two variants (c.718A > G and c.773A > C). Seven variants were found in heterozygosis, while the other two (from patients #1 and #2) in homozygosis. From these two, we only had paired blood/tumor samples from patient #1 and detected the variant only on the tumor sample, indicative of loss of heterozygosity (Additional file 1: Supplementary Fig. 1A). Similarly, we could demonstrate the somatic origin of the TP53 variants in four other patients with paired tumor/blood samples (#3, #5, #6 and #9). The remaining 21/30 variants found in USP8 wild type and all 21 variants found in the USP8 mutant tumors were described as benign, likely benign or VUS with no evidence of affecting protein function. All tumors with these variants were considered TP53 wild type. From the 21 variants found in the USP8 wild type tumors (henceforth referred to as TP53/USP8 wild type group), 7 were non-synonymous variants, 8 synonymous variants and 6 non-coding variants without splicing effect. From the 21 variants found in the 25 USP8 mutant tumors, nine were synonymous, four non-synonymous and eight non-coding without splicing effect. In addition, eight variants were found in tumors regardless of USP8 mutational status that were not categorized as TP53 mutations. The intronic variant c.782 + 62G > A was found in heterozygosis in 6/70 samples. It was not reported in any database and is not predicted to have any splicing effect. The remaining seven are common variants classified as benign or likely benign in ClinVar and their allele frequencies were similar to those reported for the general population (ALFA, gnomAD and 1000Genome project) (Additional file 1: Supplementary Table 3). Summarizing, all TP53 mutations were found in the USP8 wild type tumors, leading to a prevalence of 15% in this subgroup. Clinical presentation of patients with TP53 mutant tumors Patients with TP53 mutant tumors (n = 9) tended to be diagnosed at older age compared to TP53/USP8 wild type tumors (n = 52) (t-test P = 0.069; Table 2). This was significant after including the USP8 mutant group (n = 25) in the multiple comparison analysis (ANOVA P = 0.024, Table 2) and when TP53/USP8 wild type and USP8 mutant tumors were combined to a single group (TP53 wild type, n = 77; Additional file 1: Supplementary Table 4. We did not observe any sex specific predominance of TP53 mutations in contrast to USP8 mutants that are predominantly found in female patients. Furthermore, we did not find any statistically significant differences in ACTH and cortisol levels (Table2; Additional file 1: Supplementary Table 4). Table 2 Clinical features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups Full size table Patients with TP53 mutant tumors underwent more surgeries and tumor resection was more frequently incomplete compared to TP53/USP8 wild type (Table 2). These patients also underwent a higher number of additional therapeutic procedures (radiation, n = 7; BADX, n = 4; temozolomide, n = 3; pasireotide, n = 2). Only one patient (#4) with TP53 mutant tumor, a 77 year-old man, had a single surgery without any other treatment, but his follow-up was short (< 6 months). We observed TP53 mutations more frequently in CTP-BADX/NS (4/12, 33%) compared to CD (5/49, 10%), trending towards statistically significant difference (Fischer exact test P = 0.065 for TP53 mutant vs. TP53/USP8 wild type, P = 0.060 for comparison among the 3 groups; Table 2). The TP53 mutant group associated with higher disease-specific mortality and shorter survival than USP8 mutant or TP53/USP8 wild type groups (log rank test, P = 0.023, Fig. 1). Three patients with TP53 mutant tumors (all CTP-BADX/NS) died of disease-related deaths: two from severe cerebral hemorrhage after surgery and stereotactic radiation and one from uncontrolled disease after five failed operations, radiotherapy (gamma knife, fractionated radiation) and chemotherapy (temozolomide, bevacizumab) at the ages of 75, 80 and 37, respectively. Ten-year survival was 27% for patients with TP53 mutant tumors, 100% for TP53/USP8 wild type and 86% for USP8 mutant. In our cohort, survival did not differ after adjusting for age (HR 7.7, 95%CI 0.6–107.7, P = 0.127). Fig. 1 Kaplan–Meier curve showing overall survival in patients with TP53 mutant/USP8 wild type, USP8 mutant/TP53 wild type, and TP53 wild type/USP8 wild type corticotroph tumors. The table underneath the graph shows the 10-year cumulative survival after diagnosis Full size image Tumor samples from prior surgeries were available from one TP53 mutant case (#8, Table 1). This male patient had his first pituitary surgery for CD when he was 30 years old and was treated with γ-knife one year later. He then underwent two more pituitary surgeries and BADX until the age of 35. He developed CTP-BADX/NS with para- and retrosellar tumor extension along with panhypopituitarism and underwent two more pituitary surgeries before dying at the age of 38 due to complications of the disease. We detected the TP53 variant c.1009C > G (p.Arg337Gly) in all available tumor specimens, including his first and latest surgeries (Additional file 1: Supplementary Fig. 1B). No statistical association was found between clinical data and any of the 8 common variants. Characteristics of TP53 mutant corticotroph tumors All TP53 mutations were found in macroadenomas (9/66; Table 3). TP53 mutant tumors were larger that TP53/USP8 wild type (mm median [IQR] 20.0 [14.0] vs. 15.0 [14.3]), but this did not reach statistical significance (Table 3). Multiple comparison analysis showed that the difference in tumor size is significant only comparing TP53 mutant with USP8 mutant (median [IQR] 23.3 [14.0] vs. 14 [7.3] mm; Kruskal–Wallis P = 0.019; Bonferroni corrected P = 0.018). Table 3 Tumor features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups Full size table Parasellar invasion was reported in 34 out of 64 cases, for which this information was available, and it was more common in TP53 mutant tumors (100% vs. 53% and 55% for TP53/USP8 wild type and USP8 mutant, respectively; Fischer exact test P = 0.006). TP53 mutant tumors had higher Knosp grade (Kruskal–Wallis P = 0.011) with the majority being Knosp 4 (Table 3, Additional file 1: Supplementary Table 4). Ki67 proliferation index was available for 36 cases (6 TP53 mutant). Five out of six TP53 mutant tumors had Ki67 ≥ 3% and the overall Ki67 was higher than in the wild type tumors (Kruskal–Wallis P = 0.01; Bonferroni corrected P = 0.008 for TP53/USP8 wild type) (Table 3). Ki67 ≥ 10% was reported in 6 tumors, from which 5 were TP53 mutant (Fischer exact test P < 0.0001; the remaining case was TP53/USP8 wild type). We had information on p53 immunostaining from 9 cases (all macroadenomas), four of which TP53 mutant: 3 tumors (from patients #5, 6 and 9) showed high p53 immunoreactivity, while the one (from patient #3) carrying a nonsense variant leading to a truncated protein was p53 negative. The five TP53 wild type cases showed isolated nuclear staining in < 1–3% of cells. Summarizing, TP53 mutations were significantly associated with features related to a more aggressive tumor behavior, such as incomplete tumor resection, more frequent parasellar invasion, higher Knosp grade, and higher Ki67 proliferation index (Table 3; Additional file 1: Supplementary Table 4). Discussion Herein, we investigated the prevalence of TP53 mutations by screening a large cohort of 61 functional corticotroph tumors with USP8 wild type status, and found variants altering protein function in 15% of cases. We did not detect TP53 mutations in a separate group of 25 USP8 mutant tumors, which is in concordance with previously published small next-generation sequencing series [8, 18, 19]. Since we focused on USP8 wild type tumors, macroadenomas were overrepresented in our cohort. Consequently, it should be noted that the prevalence of TP53 mutations is expected to be lower in the general CD population. In fact, ~ 50% of corticotroph tumors carry USP8 mutations, which others and we have shown to be mutually exclusive. Corticotroph tumors with USP8 mutations are associated with female predominance, younger age at presentation, and less invasiveness (despite shorter time to relapse) [9, 11, 13, 18, 36]. In contrast, TP53 mutant tumors were diagnosed mostly at older age, did not show sex predominance and were larger and more invasive, with lower complete resection rate. None of the 19 microadenomas included in our study carried TP53 mutations. Still, we need to acknowledge that since no sample was microdissected we may have lost microadenoma cases with TP53 mutations. Instead, we found TP53 mutations in 9/66 macroadenomas (14%) and 8/34 (24%) invasive tumors, supporting the findings from smaller series [17, 19]. Tumor size at presentation or invasiveness do not reliably predict aggressiveness. Instead, the European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumors and carcinomas proposed a definition of pituitary tumor aggressiveness based on rapid or clinically relevant tumor growth despite optimal therapeutic options, along with bone invasion [37]. A recent study in a series of 9 aggressive pituitary tumors and carcinomas carrying ATRX mutations reported a high frequency of missense TP53 variants (5/9, 55.6%), further suggesting a link between TP53 mutational status and unfavorable outcome [20]. We do not have exact information on changes of tumor growth for the majority of our cases, but the higher number of surgical and radiation interventions, the higher Knosp grades, and the increased mortality rate indicate that patients with TP53 mutant tumors obviously follow a more aggressive disease course. Ki67 proliferation index together with p53 immunostaining and mitotic count have been suggested as histological markers of pituitary tumor aggressiveness [29, 38]. In our series, Ki67 was significantly higher in TP53 mutant tumors, reinforcing our prior observation of a higher proportion of TP53 mutant tumors in the Ki67 ≥ 3 group [17]. We had limited information on p53 immunohistochemistry, since this measure is not routinely performed in our collaborative centers. Nevertheless, in the few tumors with known p53 immunopositivity, it was higher in the TP53 mutant group, which is in concordance with a previous study reporting high p53 immunoreactivity in all TP53 mutant tumors [19]. A mutagenic action of radiation on TP53 has been hypothesized by small series on radiation-induced tumors. For instance, TP53 mutations were reported in 58% of radiation-induced sarcomas [39], while a meta-analysis reported TP53 mutations in 14/30 radiation-induced gliomas [40]. A previous study reported a case with frameshift TP53 mutation in the CTP-BADX/NS tumor, but not in the initial CD surgeries, and the mutation was therefore suspected to be induced by radiotherapy [41]. In our series, however, 4 out of 7 TP53 mutant tumors were obtained before radiation. In their case report, Pinto et al. suggested that TP53 mutations are acquired during tumorigenesis and condition tumor evolution [41]. In contrast, Casar-Borota et al. and Uzilov et al. reported high allele fraction of TP53 mutations, indicating that they are not a late event in corticotroph tumorigenesis [19, 20]. In addition, Uzilov et al. reported TP53 mutations in all tumor specimens from their two TP53 mutant cases with multiple surgeries [19]. Similarly, in our series we had tissue from multiple pituitary surgeries from one patient and found the TP53 variant in all samples (CD and CTP-BADX/NS), including specimens obtained before radiotherapy. Taken together, these observations suggest that in most cases, TP53 mutations may appear early during tumor development. A limitation of our study is the short follow-up of patients who were prospectively included. Moreover, material from repeated surgeries was lacking from most patients with TP53 mutant tumors, hampering the examination of tumor evolution in these patients. Similarly, we had limited access to blood samples, so we could not demonstrate the somatic origin for all variants. Nevertheless, the older age at initial diagnosis of CD in patients with TP53 mutant tumors (53 ± 19.5 years old, with the youngest patient diagnosed at the age of 30) and the absence of additional neoplasias during follow-up also support a somatic instead of a germline origin. Furthermore, conditions related to germline TP53 mutations, such as Li-Fraumeni syndrome, very rarely present with pituitary tumor [42]. To our knowledge, the only published case so far was a pediatric patient with an aggressive lactotroph tumor [43]. In addition to the TP53 mutations, we detected several common variants. Variants rs59758982 and rs1042522 have been associated with increased cancer susceptibility [44, 45]. In some cancer types, the very frequent rs1042522 c.215G > C (p.Pro72Arg) alternative variant correlated to more efficient induction of apoptosis by DNA-damaging chemotherapeutic drugs, growth suppression and higher metastatic potential [46,47,48]. In nonfunctioning pituitary tumors, alternative allele C (leading to p.Arg72) was related to early age at presentation and reduced p21 expression [49]. Very recently, an overrepresentation of the rs1042522 alternative allele C (p.Arg72) was reported in 9 out of 10 corticotroph neoplasias including 5 functional tumors (allele frequency 0.900, vs 0.714 in Latino/admixed American in gnomAD [31]) without any association with clinical features [50]. In our cohort, we did not detect different allele frequencies in any of the investigated common variants (including rs1042522) compared with public databases, nor statistical association with any clinical variable, rendering their contribution to corticotroph pathophysiology unlikely. Conclusion Screening a large corticotroph tumor series revealed that TP53 mutations are more frequent than previously considered. Furthermore, we show that patients with TP53 mutant tumors had higher number of surgeries, more invasive tumors, and worse disease outcome. Our study provides evidence that patients with pathogenic or function altering variants may require more intense treatment and extended follow-up, and suggests screening for TP53 variants in macroadenomas with wild type USP8 status. Further work is needed to determine the potential use of TP53 status as a predictor of disease outcome. Availability of data and materials The authors declare that the relevant data supporting the conclusions of this article are included within the article and its supplementary information file. Additional clinical data are available from the corresponding authors MT and LGPR upon reasonable request. Abbreviations CD: Cushing’s disease BADX: Bilateral adrenalectomy CTP-BADX/NS: Corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome ACTH: Adrenocorticotropic hormone SD: Standard deviation IQR: Interquartile range HR: Hazard ratio References Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS (2018) CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011–2015. Neuro Oncol 20:iv1-86 PubMed PubMed Central Article Google Scholar McCormack A, Dekkers OM, Petersenn S, Popovic V, Trouillas J, Raverot G et al (2018) Treatment of aggressive pituitary tumours and carcinomas: results of a European society of endocrinology (ESE) survey 2016. Eur J Endocrinol 178:265–276 CAS PubMed Article Google Scholar Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR et al (2021) Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol 9:847–875 PubMed Article Google Scholar Dimopoulou C, Schopohl J, Rachinger W, Buchfelder M, Honegger J, Reincke M et al (2013) Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: care reality in the Munich metropolitan region. Eur J Endocrinol 170:283–292 PubMed Article CAS Google Scholar Reincke M, Albani A, Assie G, Bancos I, Brue T, Buchfelder M et al (2021) Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): systematic review and expert consensus recommendations. Eur J Endocrinol 184:P1-16 CAS PubMed PubMed Central Article Google Scholar Fountas A, Lim ES, Drake WM, Powlson AS, Gurnell M, Martin NM et al (2020) Outcomes of patients with Nelson’s syndrome after primary treatment: a multicenter study from 13 UK pituitary centers. J Clin Endocrinol Metab 105:1527–1537 Article Google Scholar Kemink SA, Wesseling P, Pieters GF, Verhofstad AA, Hermus AR, Smals AG (1999) Progression of a Nelson’s adenoma to pituitary carcinoma; a case report and review of the literature. J Endocrinol Invest 22:70–75 CAS PubMed Article Google Scholar Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F et al (2015) Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet 47:31–38 CAS PubMed Article Google Scholar Pérez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA et al (2015) The Gene of the ubiquitin-specific protease 8 is frequently mutated in adenomas causing Cushing’s disease. J Clin Endocrinol Metab 100:E997-1004 PubMed PubMed Central Article Google Scholar Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F et al (2015) Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res 25:306–317 CAS PubMed PubMed Central Article Google Scholar Hayashi K, Inoshita N, Kawaguchi K, Ardisasmita AI, Suzuki H, Fukuhara N et al (2016) The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol 174:213–226 CAS PubMed Article Google Scholar Pérez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferraù F et al (2018) Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol 178:59–65 Article Google Scholar Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S et al (2018) The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf) 89:454–458 CAS Article Google Scholar Bi WL, Horowitz P, Greenwald NF, Abedalthagafi M, Agarwalla PK, Gibson WJ et al (2017) Landscape of genomic alterations in pituitary adenomas. Clin Cancer Res 23:1841–1851 CAS PubMed Article Google Scholar Song Z-J, Reitman ZJ, Ma Z-Y, Chen J-H, Zhang Q-L, Shou X-F et al (2016) The genome-wide mutational landscape of pituitary adenomas. Cell Res 26:1255–1259 CAS PubMed PubMed Central Article Google Scholar Chen J, Jian X, Deng S, Ma Z, Shou X, Shen Y et al (2018) Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat Commun 9:3171 PubMed PubMed Central Article CAS Google Scholar Sbiera S, Perez-Rivas LG, Taranets L, Weigand I, Flitsch J, Graf E et al (2019) Driver mutations in USP8 wild-type Cushing’s disease. Neuro Oncol 21:1273–1283 CAS PubMed PubMed Central Article Google Scholar Neou M, Villa C, Armignacco R, Jouinot A, Raffin-Sanson ML, Septier A et al (2020) Pangenomic classification of pituitary neuroendocrine tumors. Cancer Cell 37:123-134.e5 CAS PubMed Article Google Scholar Uzilov AV, Taik P, Cheesman KC, Javanmard P, Ying K, Roehnelt A et al (2021) USP8 and TP53 drivers are associated with CNV in a corticotroph adenoma cohort enriched for aggressive tumors. J Clin Endocrinol Metab 106:826–842 PubMed Article Google Scholar Casar-Borota O, Boldt HB, Engström BE, Andersen MS, Baussart B, Bengtsson D et al (2021) Corticotroph aggressive pituitary tumors and carcinomas frequently harbor ATRX mutations. J Clin Endocrinol Metab 106:1183–1194 PubMed Article Google Scholar Campbell PJ, Getz G, Korbel JO, Stuart JM, Jennings JL, Stein LD et al (2020) Pan-cancer analysis of whole genomes. Nature 578:82–93 Article CAS Google Scholar Bouaoun L, Sonkin D, Ardin M, Hollstein M, Byrnes G, Zavadil J et al (2016) TP53 variations in human cancers: new lessons from the IARC TP53 database and genomics data. Hum Mutat 37:865–876 CAS PubMed Article Google Scholar Horbinski C, Ligon KL, Brastianos P, Huse JT, Venere M, Chang S et al (2019) The medical necessity of advanced molecular testing in the diagnosis and treatment of brain tumor patients. Neuro Oncol 21:1498–1508 CAS PubMed PubMed Central Article Google Scholar van Riet J, van de Werken HJG, Cuppen E, Eskens FALM, Tesselaar M, van Veenendaal LM et al (2021) The genomic landscape of 85 advanced neuroendocrine neoplasms reveals subtype-heterogeneity and potential therapeutic targets. Nat Commun 12:4612 PubMed PubMed Central Article CAS Google Scholar Herman V, Drazin NZ, Gonsky R, Melmed S (1993) Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab 77:50–55 CAS PubMed Google Scholar Levy A, Hall L, Yeudall WA, Lightman SL (1994) p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf) 41:809–814 CAS Article Google Scholar Tanizaki Y, Jin L, Scheithauer BW, Kovacs K, Roncaroli F, Lloyd RV (2007) P53 gene mutations in pituitary carcinomas. Endocr Pathol 18:217–222 CAS PubMed Article Google Scholar Kawashima ST, Usui T, Sano T, Iogawa H, Hagiwara H, Tamanaha T et al (2009) P53 gene mutation in an atypical corticotroph adenoma with Cushing’s disease. Clin Endocrinol (Oxf) 2009:656–657 Article Google Scholar Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G et al (2013) A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol 126:123–135 PubMed Article Google Scholar Phan J, Jin Y, Zhang H, Qiang W, Shekhtman E, Shao D et al (2020) ALFA: allele frequency aggregator: national center for biotechnology information, U.S. National Library of Medicine. Available from www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa/ Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alföldi J, Wang Q et al (2020) The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581:434–443 CAS PubMed PubMed Central Article Google Scholar Fairley S, Lowy-Gallego E, Perry E, Flicek P (2020) The International genome sample resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res 48:D941–D947 CAS PubMed Article Google Scholar Kato S, Han S-Y, Liu W, Otsuka K, Shibata H, Kanamaru R et al (2003) Understanding the function–structure and function–mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci 100:8424–8429 CAS PubMed PubMed Central Article Google Scholar Kawaguchi T, Kato S, Otsuka K, Watanabe G, Kumabe T, Tominaga T et al (2005) The relationship among p53 oligomer formation, structure and transcriptional activity using a comprehensive missense mutation library. Oncogene 24:6976–6981 CAS PubMed Article Google Scholar Greenblatt MS, Chappuis PO, Bond JP, Hamel N, Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61:4092–4097 CAS PubMed Google Scholar Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D et al (2020) Ubiquitin-Specific Protease 8 mutant corticotrope adenomas present unique secretory and molecular features and shed light on the role of ubiquitylation on ACTH processing. Neuroendocrinology 110:119–129 CAS PubMed Article Google Scholar Raverot G, Burman P, McCormack A, Heaney A, Petersenn S, Popovic V et al (2018) European society of endocrinology clinical practice guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 178:G1-24 CAS PubMed Article Google Scholar Thapar K, Scheithauer BW, Kovacs K, Pernicone PJ, Laws ER (1996) p53 expression in pituitary adenomas and carcinomas: correlation with invasiveness and tumor growth fractions. Neurosurgery 38:765–70 CAS PubMed Article Google Scholar Gonin-Laurent N, Gibaud A, Huygue M, Lefèvre SH, Le Bras M, Chauveinc L et al (2006) Specific TP53 mutation pattern in radiation-induced sarcomas. Carcinogenesis 27:1266–1272 CAS PubMed Article Google Scholar Whitehouse JP, Howlett M, Federico A, Kool M, Endersby R, Gottardo NG (2021) Defining the molecular features of radiation-induced glioma: a systematic review and meta-analysis. Neuro-Oncol Adv 3:1–16 Google Scholar Pinto EM, Siqueira SACC, Cukier P, Fragoso MCBVCBV, Lin CJ, De Mendonca BB et al (2011) Possible role of a radiation-induced p53 mutation in a Nelson’s syndrome patient with a fatal outcome. Pituitary 14:400–404 PubMed Article Google Scholar Orr BA, Clay MR, Pinto EM, Kesserwan C (2020) An update on the central nervous system manifestations of Li–Fraumeni syndrome. Acta Neuropathol 139:669–87 CAS PubMed Article Google Scholar Birk H, Kandregula S, Cuevas-Ocampo A, Wang CJ, Kosty J, Notarianni C (2022) Pediatric pituitary adenoma and medulloblastoma in the setting of p53 mutation: case report and review of the literature. Childs Nerv Syst. https://doi.org/10.1007/s00381-022-05478-8 Article Google Scholar Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS (2004) Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 210:151–157 CAS PubMed Article Google Scholar Sagne C, Marcel V, Amadou A, Hainaut P, Olivier M, Hall J (2013) A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): geographic and tumor-specific effects. Cell Death Dis 4:e492 CAS PubMed PubMed Central Article Google Scholar Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H et al (2009) Prognostic significance of p53 Codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clin Cancer Res 15:2406–2416 CAS PubMed PubMed Central Article Google Scholar Dumont P, Leu JIJ, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33:357–365 CAS PubMed Article Google Scholar Basu S, Gnanapradeepan K, Barnoud T, Kung CP, Tavecchio M, Scott J et al (2018) Mutant p53 controls tumor metabolism and metastasis by regulating PGC-1α. Genes Dev 32:230–243 CAS PubMed PubMed Central Article Google Scholar Yagnik G, Jahangiri A, Chen R, Wagner JR, Aghi MK (2017) Role of a p53 polymorphism in the development of nonfunctional pituitary adenomas. Mol Cell Endocrinol 446:81–90 CAS PubMed PubMed Central Article Google Scholar Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I et al (2022) The genomic landscape of corticotroph tumors: from silent adenomas to ACTH-secreting carcinomas. Int J Mol Sci. 23:4861 CAS PubMed PubMed Central Article Google Scholar Download references Funding Open Access funding enabled and organized by Projekt DEAL. The study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Project number: 314061271-TRR 205 to MF, MR and MT; FA 466/5-1 to MF; DE 2657/1-1 to TD), Metiphys program of the LMU Medical Faculty (to AA), Else Kröner-Fresenius Stiftung (Project number: 2012_A103 and 2015_A228 to MR) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; Project number: E-26/211.294/2021 to MRG). Author information Authors and Affiliations Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, Germany Luis Gustavo Perez-Rivas, Julia Simon, Adriana Albani, Sicheng Tang, Günter K. Stalla, Martin Reincke & Marily Theodoropoulou Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, Munich, Germany Sigrun Roeber & Jochen Herms Department of Endocrinology, Center for Rare Adrenal Diseases, Assistance Publique-Hôpitaux de Paris, Hôpital Cochin, Paris, France Guillaume Assié Université de Paris, Institut Cochin, Inserm U1016, CNRS UMR8104, F-75014, Paris, France Guillaume Assié Division of Endocrinology and Diabetes, Department of Internal Medicine I, University Hospital, University of Würzburg, Würzburg, Germany Timo Deutschbein & Martin Fassnacht Medicover Oldenburg MVZ, Oldenburg, Germany Timo Deutschbein Division of Endocrinology, Hospital Universitário Clementino Fraga Filho, Rio de Janeiro, Brazil Monica R. Gadelha Division of Endocrinology, Department of Internal Medicine, Radboud University Medical Centre, Nijmegen, The Netherlands Ad R. Hermus Medicover Neuroendocrinology, Munich, Germany Günter K. Stalla Service d’Endocrinologie, Centre Hospitalier du Nord, Ettelbruck, Luxembourg Maria A. Tichomirowa Department of Neurosurgery, Universitätskrankenhaus Hamburg-Eppendorf, Hamburg, Germany Roman Rotermund & Jörg Flitsch Department of Neurosurgery, University of Erlangen-Nürnberg, Erlangen, Germany Michael Buchfelder Department of Neurosurgery, University of Tübingen, Tübingen, Germany Isabella Nasi-Kordhishti & Jürgen Honegger Neurochirurgische Klinik und Poliklinik, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, Germany Jun Thorsteinsdottir Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany Wolfgang Saeger Contributions LPGR and MT designed the study. LPGR, JS, AA and ST implemented the study. LGPR did the data analysis. SR, GA, TD, MF, MRG, ARH, GKS, MAT, RR, JF, MB, INK, JH, JT, WS, JH and MR provided patient materials and data. LGPR and MT interpreted the data and composed the main draft of the manuscript. All authors have seen, corrected and approved the final draft. Corresponding authors Correspondence to Luis Gustavo Perez-Rivas or Marily Theodoropoulou. Ethics declarations Ethics approval and consent to participate The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of the LMU Munich (Nr. 643-16). All patients provided written informed consent. Competing interests The authors declare that they have no competing interests. Additional information Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Supplementary Information Additional file 1 of TP53 mutations in functional corticotroph tumors are linked to invasion and worse clinical outcome Skip to file navigationSkip to generic navigation 1 Supplementary Table 1 . Description of study cohort. Variable mean/median SD/IQR Total n Age at diagnosis (years), mean ±SD, [total n] 42 ±15.2 86 Sex (female), n (%), [total n] 62 (72%) 86 BMI (kg/m2), mean ±SD, [total n] 28.9 ±6.3 74 Disease presentation, n (%), [total n] 86 Cushing 66 (77%) Nelson 20 (23%) Number of prior pituitary surgeries, n (%), [total n] 80 0 50 (63%) 1 23 (29%) ≥2 7 (9%) Total number of pituitary surgeries, n (%), [total n] 82 1 46 (56%) 2 23 (28%) ≥3 13 (16%) Complete tumor resection, n (%), [total n] 32 (60%) 53 Postoperative remission, n (%), [total n] 46 (59%) 78 Postoperative tumor control, n (%), [total n] 34 (60%) 57 Radiation therapy, n (%), [total n] 24 (34%) 70 Radiation therapy before sample collection, n (%), [total n] 7 (13%) 53 Bilateral adrenalectomy, n (%), [total n] 23 (27%) 86 Pharmacological treatments a , n (%), [total n] 18 (42%) 43 Preoperative hormone levels Plasma ACTH (pg/mL), median (IQR) 98 (570.4) 75 Serum cortisol ( μ g/dl), median (range) 29.1 (168.6) 50 24h - urinary free cortisol ( μ g/24h), median (range) 432.5 (598.3) 30 Serum cortisol after low - dose DST ( μ g/dl), median (IQR) 20 (20.7) 46 Postoperative hormone levels Plasma ACTH (pg/mL), median (IQR) 20 (107.6) 57 Serum cortisol nadir ( μ g/dl), median (range) 8.8 (19.4) 58 Tumo r size (mm), median (IQR), [total n] 15 (13.0) 85 Microadenoma 19 (22%) Macroadenoma 66 (78%) Granulation, n (%), [total n] 30 Sparsely 9 (30%) Densely 21 (70%) Ki67 index, median (IQR), [total n] 2.0 (3.8) 36 Ki67 index ≥3%, n (%) 14 (39%) 36 p53 positivity, median (IQR), [total n] 1 (26.5) 9 Invasion, n (%), [total n] 34 (53%) 64 Hardy grade, n (%), [total n] 61 1 13 (21%) 2 22 (36%) 3 18 (30%) 4 8 (13%) Knosp grade, n (%), [total n] 35 0 5 (14%) 1 12 (34%) 2 3 (9%) 3 7 (20%) 4 8 (7%) Disease - specific death, n (%), [total n] 5 (9%) 58 a Pharmacological treatments: pasireotide (n=6), ketoconazole (n=5), mitotane (n=5), temozolamide (n=4) metyrapone (n=5), cabergoline (n=3), bevazizumab (n=1). Five patients received >1 pharmacological agent. 2 Supplementary Table 2 . Primers used for TP53 amplification and Sanger sequencing. Primer Sequence DNA source TP53 - 1 5' - TCTCATGCTGGATCCCCACT - 3' FF, FFPE TP53 - 1rv 5' - GACCAGGTCCTCAGCC - 3' FFPE TP53 - 2fw 5' - GGGGGCTGAGGACCTGGT - 3' FFPE TP53 - 2rv 5' - ATACGGCCAGGCATTGAAGT - 3' FFPE TP53 - 2 5' - AGAGGAATCCCAAAGTTCCA - 3' FF TP53 - 3 5' - GTGCCCTGACTTTCAACTC - 3' FF, FFPE TP53 - 3rv 5' - GGCAACCAGCCCTGTC - 3' FFPE TP53 - 4fw 5' - GCCTCTGATTCCTCACTGAT - 3' FFPE TP53 - 4 5' - CAGGAGAAAGCCCCCCTACT - 3' FF, FFPE TP53 - 5 5' - CTTGCCACAGGTCTCCCCAA - 3' FF, FFPE TP53 - 6 5' - AGGGGTCAGAGGCAAGCAGA - 3' FF, FFPE TP53 - 7 5' - TAGGACCTGATTTCCTTA - 3' FF, FFPE TP53 - 7rv 5' - AGTGAATCTGAGGCATAAC - 3' FFPE TP53 - 7Bfw 5' - TGGAGGAGACCAAGGGTG - 3' FFPE TP53 - 7Brv 5' - CGGCATTTTGAGTGTTAGAC - 3' FFPE TP53 - 8 5' - TAAGCTATGATGTTCCTTAG - 3' FF, FFPE TP53 - 8rv 5' - GACTGTTTTACCTGCAATTG - 3' FFPE TP53 - 9 5' - CAATTGTAACTTGAACCATC - 3' FF, FFPE TP53 - 10 5' - GGATGAGAATGGAATCCTAT - 3' FF, FFPE TP53 - 11 5' - TCTCACTCATGTGATGTCATC - 3' FF, FFPE TP53 - 12 5' - CACACCTATTGCAAGCAAGG - 3' FF, FFPE FF, fresh frozen; FFPE, formalin - fixed paraffin embedded. figshare Download Additional file 1 Additional file 1. Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS. Additional file 1 . Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS. Rights and permissions Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Reprints and Permissions From https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-022-01437-1#Abs1

Cortisol isn’t bad; you need it to help regulate your responses to life. Regulation involves a very complex interplay of feedback loops between the hypothalamus, pituitary gland, and adrenal glands, says Dr. Singh. “In general, cortisol levels tend to peak in the late morning and gradually decline throughout the day,” he explains. “When a stressful event occurs, the increased cortisol will work alongside our ‘fight or flight’ mechanisms to either upregulate or downregulate bodily functions. [Affected systems include] the central nervous system, cardiovascular system, gastrointestinal system, or immune system.” In addition to normal processes that trigger or suppress cortisol release, levels can also be affected by different medical conditions, Dr. Singh says. For example, if someone has abnormally high levels of cortisol, this is called Cushing’s syndrome, which is typically caused by a tumor affecting any of the glands that take part in the process of cortisol production. When people suffer from abnormally low levels of cortisol, it’s called Addison’s disease. It generally occurs due to adrenal gland dysfunction, but could also be the result of abnormal functioning of any of the other glands in the cortisol production process. Finally, if you use corticosteroid medications such as prednisone or dexamethasone, prolonged use will result in excessive cortisol production, Dr. Singh says. “If the medication is not adequately tapered down when discontinued, the body’s ability to create cortisol can become permanently impaired,” he says. From https://www.yahoo.com/lifestyle/manage-pesky-stress-hormone-cortisol-184900397.html

Recordati Rare Diseases, a US biopharma that forms part of the wider Italian group, has presented multiple positive data sets on Isturisa (osilodrostat) at the annual ENDO 2022 meeting in Atlanta, Georgia. Isturisa is a cortisol synthesis inhibitor indicated for the treatment of adult patients with Cushing’s disease for whom pituitary surgery is not an option or has not been curative. Among the data presented, the Phase III LINC 4 study demonstrated that Isturisa maintained normal mean urinary free cortisol long-term in patients with Cushing’s disease while the Phase III LINC 3 study found adrenal hormone levels changed during early treatment with the drug while stabilizing during long-term treatment. The ILLUSTRATE study also showed patients treated with a prolonged titration interval tended to have greater persistence with therapy. Mohamed Ladha, president and general manager for North America, Recordati Rare Diseases, said: “The data from these studies reinforces the efficacy and safety of Isturisa as a treatment for patients with Cushing’s disease. “We are pleased to share these data with the endocrine community and are excited to provide patients with a much-needed step forward in the management of this rare, debilitating, and potentially life-threatening condition.” Cushing’s disease is a rare, serious illness caused by a pituitary tumor that leads to overproduction of cortisol by the adrenal glands. Excess cortisol can contribute to an increased risk of morbidity and mortality. Treatment for the condition seeks to lower cortisol levels to a normal range. Isturisa, which was approved by the US Food and Drug Administration in March 2020, works by inhibiting 11-beta-hydroxylase, an enzyme responsible for the final step of cortisol biosynthesis in the adrenal gland. From https://www.thepharmaletter.com/article/results-reinforce-efficacy-of-recordati-s-isturisa-in-cushing-s-disease

Abstract Cushing syndrome is a rare disease that rarely presents as acute psychosis. In this case, the patient presented with acute psychosis and agitation as the first manifestations of the disease which led to the admission of the patient to a psychiatry hospital for one month, as it was difficult to restrain her sufficiently for performing appropriate diagnostic tests due to disturbing behavior. She responded well to treatment with olanzapine and lorazepam to treat the patient’s agitation, and successfully complete her evaluation. Thereafter, she was diagnosed with a pituitary tumor and underwent pituitary lesion resection via a microscopic transsphenoidal as needed. Two months after surgery, her cortisol levels returned to baseline, and she became calmer and decreased the tensity of her psychosis; however, it was only five months after surgery that her psychotic symptoms and disturbed behavior ceased. Introduction Cushing syndrome is comprised of a group of symptoms induced by prolonged exposure to high blood cortisol levels [1]. It is a rare disease, occurring in approximately 2.4 per million individuals per year [2]. Psychiatric and cognitive manifestations of Cushing syndrome occur in 70%-85% of patients, with irritability, emotional lability, and depression occurring most commonly. Rarer symptoms include mania, panic attacks, anxiety, suicidal ideation, and acute psychosis [3-5]. In this article, we describe a patient with Cushing syndrome who developed psychosis with agitation as the first manifestation of Cushing syndrome. The patient was difficult to manage since her agitation and refusal to undergo evaluation prevented her from receiving outpatient care. Case Presentation A 22-year-old woman with a three-month history of an increase in appetite, binge eating, and weight gain. After two weeks of her initial symptoms, she started to have grandiose and persecutory delusions, auditory hallucinations, decreased need for sleep, agitation, irritability, and aggression for which she went to a private psychiatry clinic and was given 10 mg olanzapine oral at night. After a month of starting oral olanzapine, she was not improving and was admitted to the psychiatry ward for evaluation. During her admission period, she started to have cognitive symptoms including worsened memory, attention, and orientation. After one month of admission with no improvement on medication, she was noted to have moon face and high blood pressure, and her laboratory investigation showed mild hypokalemia, high cortisol level, and adrenocorticotropic hormone (ACTH), elevated liver enzymes, and mild hypertriglyceridemia. A magnetic resonance imaging (MRI) scan of the brain revealed a 6 × 2-mm hyperintense lesion in the anterior pituitary on a T2-weighted image; therefore, she was transferred to our hospital for further work up and management as we have the endocrine facility. She had no past psychiatric history or family history of psychiatric illnesses, nor a history of substance abuse. She also had no past medical history and was not on any medication prior to this presentation. The patient was admitted to the endocrine department to evaluate the possibility of Cushing syndrome. Her blood pressure (150/98), heart rate (128 BPM), and respiratory rate (30 BPM) were elevated. She was treated with losartan, amlodipine, and spironolactone. Basic labs were done (Table 1). Therefore, insulin therapy was initiated. The evaluation of the patient’s condition was difficult as she was aggressive and uncooperative due to a lack of insight. Her primary team planned for sedation with anesthesia to facilitate a clinical evaluation; however, no intensive care unit bed was available. Lab test Patient result Reference values cortisol levels 1549 nmol/L 140 to 690 nmol/L ACTH (Adrenocorticotropic Hormone) 54 pg/mL 10 to 50 pg/mL ALT (Alanine transaminase) 305 U/L 7 to 56 U/L AST (Aspartate aminotransferase) 112 U/L 8 to 33 U/L Alkaline phosphatase 141 IU/L 44 to 147 IU/L Hemoglobin A1c 7.3% 5.7% to 6.4% Table 1: Lab results for the patient when she first came to our hospital Psychiatry was consulted to manage agitation. We started her on 5 mg olanzapine oral twice daily, and 2 mg lorazepam three times daily intravenous when oral was not possible. Maximum dosage of 5 mg olanzapine and 2 mg lorazepam every four hours were administered as required to manage agitation. Her ECG showed a QTC of 464. One-to-one nurse observation was initiated to detect risky behaviors. The patient slept well and became calmer and more cooperative throughout evaluations when receiving medication. One-to-one nurse observation was discontinued after five days, and lorazepam administration was reduced to two times daily. She remained easily provoked with grandiose and persecutory delusions, auditory hallucinations, and confusion. As the patient calmed, the primary team continued clinical evaluations. A contrast-enhanced MRI showed a focal non-deforming and hypo-enhancing lesion, measuring 7 mm (AP) x 6 mm (TV) x 6 mm (CC), in the anterior pituitary (Figures 1, 2). A minimal leftward deviated pituitary stalk with normal thickness was also identified. An 8 mg dexamethasone suppression test revealed cortisol levels had decreased from 1,500 to 900 nmol/L. The 24-hour cortisol level was not determined, as the patient was easily provoked. Inferior petrosal sinus sampling was performed under general anesthesia. These results are consistent with central Cushing disease. Figure 1: Coronal T1-weighted MRI of the pituitary gland with contrast showed a hypoenhancing nodular lesion at the midline of the anterior pituitary, with mild eccentric to the right Figure 2: Brain MRI sagittal view showing focal anterior pituitary hypoenhancing lesion at the midline and eccentric to the right Treatment with 250 mg metyrapone twice daily was initiated and the patient was scheduled for pituitary lesion resection via a microscopic transsphenoidal approach by neurosurgery. Her blood tests began normalizing post-surgery except for low cortisol (Table 2), and her vital signs were within normal range. Medications regulating blood pressure and glucose levels were decreased to monotherapy and discontinued thereafter. And 40 and 20 mg doses of hydrocortisone administered in the morning and night, respectively, were tapered to 5 mg twice daily over a period of two months after the surgery, and cortisol levels were regulated reaching 167 nmol/L. Agitation and irritability, grandiose and persecutory delusion and auditory hallucination tensity were reduced, with intact cognitive and memory function. Therefore, medication dosages were gradually reduced, starting with lorazepam. Lab Test Patient result Reference values cortisol levels 68 nmol/L 140 to 690 nmol/L ACTH (Adrenocorticotropic Hormone) 25 pg/ml 10 to 50 pg/mL ALT (Alanine transaminase) 17.2 U/L 7 to 56 U/L AST (Aspartate aminotransferase) 19.2 U/L 8 to 33 U/L Alkaline phosphatase 121 IU/L 44 to 147 IU/L TSH (Thyroid Stimulating Hormone) 1.8 mIU/L 0.5 to 5.0 mIU/L Table 2: Lab results after the surgery. Before discharge, the patient’s psychotropic medications were withheld by the primary team for two days due to oversedation. Upon discharge, due to the side effects of olanzapine, the patient was switched to oral risperidone 1 mg at night, with 0.5 mg oral clonazepam twice daily as needed for agitation and psychosis. Throughout follow-up, the patient experienced ongoing psychosis with disturbed behavior even though she is using received clonazepam twice daily. Therefore, her dosage of risperidone was increased to 2 mg orally at night, and oral clonazepam (0.5 to 1 mg) was administered three times daily as needed to manage agitation. After three months of discharge (five months from surgical intervention), her levels of agitation and irritability decreased, delusions and auditory hallucinations ceased, and she returned to baseline, and clonazepam was discontinued and risperidone dosage was tapered to 0.5 mg with observation and follow up in the clinic, and no symptom relapse was observed. The complete discontinuation of her medications is planned next visit while monitoring the patient for signs of relapse. Discussion Cushing syndrome may initially present as psychosis, which may be misdiagnosis as a primary psychotic disorder, delaying the proper diagnosis and management. Our patient presented to a psychiatry hospital before being referred to us because she resisted psychosis treatment, the resistance to treatment of primary illness due to psychiatric manifestation is not uncommon, as Fujii et al. [6] reported the management of a patient who resisted schizophrenia treatment for 10 years before being diagnosed with Cushing syndrome. Agitation with psychosis is likely the main obstacle for properly evaluating, diagnosing, and treating patients with Cushing syndrome. In our patient, we aimed to reduce her agitation to facilitate clinical evaluation. The organic cause of psychosis often responds poorly to antipsychotic medication and exhibits a challenge in managing agitation which necessitate the utilization of highly sedating medications, to facilitate further clinical evaluation. Shah et al. [7] reported similar difficulty treating a patient with agitation despite prescribing lorazepam and 1 mg haloperidol twice daily, agitation was poorly controlled. In our case, the patient responds to a high dose of Olanzapine with lorazepam in a better way than the case report that was managed with haloperidol with lorazepam. Psychiatric symptoms secondary to medical conditions usually occur transiently and they resolve after treatment of the primary cause, however, the duration for complete resolution of symptoms is unknown. In our case, the patient gradually improved for three months prior to achieving remission, whereas a patient reported by Wu et al. [8] went into complete remission one-month post-cortisol level correction. Conclusions Cushing syndrome, like many other endocrine diseases, can present as treatment-resistant psychiatric symptoms, which may be missed and treated as a primary psychiatric illness due to the lack of proper assessment and management. In this study, we tried to correlate the psychiatric symptoms with Cushing syndrome, the challenges we faced, and the response to the treatment. Our case report gives an insight into possible rare secondary causes of psychosis and advice a thorough evaluation of patients. References Your bibliography. (2021). Accessed: March 27, 2021: https://www.ncbi.nlm.nih.gov/books/NBK470218/. Etxabe J, Vazquez JA: Morbidity and mortality in Cushing's disease: an epidemiological approach. Clin Endocrinol (Oxf). 1994, 40:479-84. 10.1111/j.1365-2265.1994.tb02486.x Starkman MN, Schteingart DE: Neuropsychiatric manifestations of patients with Cushing’s syndrome. Relationship to cortisol and adrenocorticotropic hormone levels. Arch Intern Med. 1981, 215:9. 10.1001/archinte.1981.00340020077021 Dorn LD, Burgess ES, Dubbert B, et al.: Psychopathology in patients with endogenous Cushing's syndrome: 'atypical' or melancholic features. Clin Endocrinol (Oxf). 1995, 43:433-42. 10.1111/j.1365-2265.1995.tb02614.x Sharma ST, Nieman LK, Feelders RA: Cushing's syndrome: epidemiology and developments in disease management. Clin Epidemiol. 2015, 7:281-93. 10.2147/CLEP.S44336 Fujii Y, Mizoguchi Y, Masuoka J, et al.: Cushing’s syndrome and psychosis: a case report and literature review. Prim Care Companion CNS Disord. 2018, 20:18br02279. 10.4088/PCC.18br02279 Shah K, Mann I, Reddy K, John G: A case of severe psychosis due to Cushing’s syndrome secondary to primary bilateral Macronodular adrenal hyperplasia. Cureus. 2019, 11:e6162. 10.7759/cureus.6162 Wu Y, Chen J, Ma Y, Chen Z: Case report of Cushing’s syndrome with an acute psychotic presentation. Shanghai Arch Psychiatry. 2016, 28:169-72. 10.11919/j.issn.1002-0829.215126 From https://www.cureus.com/articles/98986-cushings-syndrome-with-acute-psychosis-a-case-report

The popular website "How Stuff Work"s is doing a survey of all kinds of diseases and Cushing's is one of them! Share your information and help get the word out to the world in general. (I'm MaryO there, too and I shared about my pituitary surgery and its aftermath. I hope this info helps someone else like these boards and related websites have) The questionnaire is here: https://stuff.health/s/u0A9djA5 Together, we’ll figure out which treatments work best for Cushing's syndrome.

Osilodrostat is associated with improvements in physical manifestations of hypercortisolism and reductions in mean body weight and BMI in adults with Cushing’s syndrome, according to a speaker. As Healio previously reported, in findings from the LINC 4 phase 3 trial, osilodrostat (Isturisa, Recordati) normalized mean urinary free cortisol level at 12 weeks in more than 75% of adults with Cushing’s disease. In new findings presented at the AACE Annual Scientific and Clinical Conference, most adults with Cushing’s syndrome participating in the LINC 3 phase 3 trial had improvements in physical manifestations of hypercortisolism 72 weeks after initiating osilodrostat, with more than 50% having no dorsal fat pad, supraclavicular fat pad, facial rubor, proximal muscle atrophy, striae, ecchymoses and hirsutism for women at 72 weeks. Source: Adobe Stock “Many patients with Cushing’s syndrome suffer from clinical manifestations related to hypercortisolism,” Albert M. Pedroncelli, MD, PhD, head of clinical development and medical affairs for Recordati AG in Basel, Switzerland, told Healio. “The treatment with osilodrostat induced a rapid normalization of cortisol secretion, and improvements in physical manifestations associated with hypercortisolism were observed soon after initiation of osilodrostat and were sustained throughout the study.” Albert M. Pedroncelli Pedroncelli and colleagues analyzed changes in the physical manifestations of hypercortisolism in 137 adults with Cushing’s syndrome (median age, 40 years; 77.4% women) assigned osilodrostat. Dose titration took place from baseline to 12 weeks, and therapeutic doses were administered from 12 to 48 weeks, with some participants randomly assigned to withdrawal between 26 and 34 weeks. An extension phase of the trial took place from 48 to 72 weeks. Investigators subjectively rated physical manifestations of hypercortisolism in participants as none, mild, moderate or severe. Participants were evaluated at baseline and 12, 24, 34, 48 and 72 weeks. At baseline, the majority of the study cohort had mild, moderate or severe physical manifestations of hypercortisolism in most individual categories, including dorsal fat pad, central obesity, supraclavicular fat pad, facial rubor, hirsutism in women and striae. Central obesity was the most frequent physical manifestation rated as severe. The percentage of participants with improvements in physical manifestations of hypercortisolism increased from week 12 on for all individual manifestations evaluated in the study, and improvements were maintained through week 72. At 72 weeks, the percentage of participants who had no individual physical manifestations was higher than 50% for each category except central obesity, where 30.6% of participants had no physical manifestations. In addition to improvement in physical manifestations, the study cohort had decreases in body weight, BMI and waist circumference at weeks 48 and 72 compared with baseline. “The main goal of treating patients with Cushing’s syndrome is to normalize cortisol secretion,” Pedroncelli said. “The rapid reduction and normalization of cortisol levels is accompanied by improvement in the associated clinical manifestations. This represents an important objective for patients.” From https://www.healio.com/news/endocrinology/20220512/osilodrostat-improves-physical-manifestations-of-hypercortisolism-for-most-adults

She experienced extreme weight gain, thin skin and a racing heart. It took years to finally solve the medical mystery. Angela Yawn went to a dozen doctors before finally getting a diagnosis for her life-disrupting symptoms.Courtesy Angela Yawn April 27, 2022, 10:52 AM EDT / Source: TODAY By A. Pawlowski When a swarm of seemingly unrelated symptoms disrupted Angela Yawn’s life, she thought she was going crazy. She gained weight — 115 pounds over six years — even as she tried to eat less. Her skin tore easily and bruises would stay on her body for months. Her face would suddenly turn blood red and hot to the touch as if she had a severe sunburn. She suffered from joint swelling and headaches. She felt tired, anxious and depressed. Her hair was falling out. Then, there was the racing heart. “I would put my hand on my chest because it made me feel like that’s what I needed to do to hold my heart in,” Yawn, 49, who lives in Griffin, Georgia, told TODAY. “I noticed it during the day, but at night when I was trying to lie down and sleep, it was worse because I could do nothing but hear it beat, feel it thump." Yawn, seen here before the symptoms began, had no problems with weight before.Courtesy Angela Yawn Yawn was especially frustrated by the weight gain. Even when she ate just 600 calories a day — consuming mostly lettuce leaves — she was still gaining about 2 pounds a day, she recalled. A doctor told her to exercise more. Yawn gained 115 pounds over six years. "When the weight really started to pile on, I stayed away from cameras as I felt horrible about myself and looking back at this picture is still very embarrassing for me but I wanted (people) to see what this disease has the potential to do if not diagnosed," she said.Courtesy Angela Yawn In all, Yawn went to a dozen doctors and was treated for high blood pressure and congestive heart failure, but nothing helped. As a last resort, she sought out an endocrinologist in February of 2021 and broke down in her office. “That was the last hope I had of just not lying down and dying because at that point, that’s what I wanted to do,” Yawn said. “I thought the problem was me. I thought that I’m making up these issues, that maybe I’m bipolar. I was going crazy.” What is Cushing disease? When the endocrinologist suddenly started listing all of her symptoms without being prompted, Yawn stopped crying. Blood tests and an MRI finally confirmed the doctor’s suspicion: Yawn had a tumor in her pituitary gland — a pea-size organ at the base of the brain — that was causing the gland to release too much adrenocorticotropic hormone. That, in turn, flooded her body with cortisol, a steroid hormone that’s normally released in response to stress or danger. The resulting condition is called Cushing disease. Imagine the adrenaline rush you’d get while jumping out of an airplane and skydiving — that’s what Yawn felt all the time, with harmful side-effects. Yawn was making six times the cortisol she needed, said Dr. Nelson Oyesiku, chair of neurosurgery at UNC Health in Chapel Hill, North Carolina, who removed her tumor last fall. “That’s a trailer load of cortisol. Day in, day out, morning, noon and night, whether you need it or not, your body just keeps making this excess cortisol. It can wreak havoc in the body physiology and metabolism,” Oyesiku told TODAY. The steroid regulates blood pressure and heart rate, which is why Yawn's skin was flushed and her heart was racing, he noted. It can regulate how fat is burned and deposited in the body, which is why Yawn was gaining weight. Other effects of the steroid's overproduction include fatigue, thin skin with easy bruising, mental changes and high blood sugar. Cushing disease is rare, affecting about five people per million each year, so most doctors will spend their careers without ever coming across a case, Oyesiku said. That’s why patients often go years without being diagnosed: When they complain of blood sugar problems or a racing heart, they’ll be treated for much more common issues like diabetes or high blood pressure. Pituitary gland is hard to reach Removing Yawn’s tumor in September of 2021 would require careful maneuvering. If you think of the head as a ball, the pituitary gland sits right at the center, between the ears, between the eyes and about 4 inches behind the nose, Oyesiku said. It’s called the “master gland” because it regulates other glands in the body that make hormones, he noted. The location of the pituitary gland makes it heard to reach.janulla / Getty Images It’s a very difficult spot to reach. To get to it, Oyesiku made an incision deep inside Yawn’s nose in a small cavity called the sphenoid sinus. Using a long, thin tube that carried a light and a camera, he reached the tiny tumor — about the size of a rice grain — and removed it using special instruments. The surgery took four hours. The potential risk is high: The area is surrounded by vessels that carry blood to the brain, and it’s right underneath optic nerves necessary for a person to see. If things go wrong, patients can become blind, brain dead, or die. Recovery from surgery Today, Yawn is slowly returning to normal. She has lost 41 pounds and continues to lose weight. Her hair is no longer falling out. But patients sometimes require months or even a few years to adjust to normal cortisol levels. “It takes some time to unwind the effects of chronic exposure to steroids, so your body has to adapt to the new world order as the effects of the steroids recede,” Oyesiku said. "My life was on hold for five years... I'm trying not to be too impatient," Yawn said.Courtesy Angela Yawn Yawn’s body was so used to that higher cortisol level that she’s had to rely on steroid supplements to feel normal after the surgery. It’s like an addict going through withdrawal, she noted. The next step is finishing another cycle of supplements and then slowly tapering off them so that her body figures out how to function without the steroid overload. “I am definitely moving in the right direction,” she said. "I hope that I’ll get back to that woman I used to be — in mind, body and spirit." From https://www.today.com/health/health/cushing-disease-pituitary-gland-tumor

I don't know if there's anything of interest here - or the cost - but possibly useful to someone. Cushing’s Syndrome Diagnostic and Treatment Market research report is the new statistical data source added by Research Cognizance. “Cushing’s Syndrome Diagnostic and Treatment Market is growing at a High CAGR during the forecast period 2022-2029. The increasing interest of the individuals in this industry is that the major reason for the expansion of this market”. Cushing’s Syndrome Diagnostic and Treatment Market research is an intelligence report with meticulous efforts undertaken to study the right and valuable information. The data which has been looked upon is done considering both, the existing top players and the upcoming competitors. Business strategies of the key players and the new entering market industries are studied in detail. Well explained SWOT analysis, revenue share, and contact information are shared in this report analysis. Get the PDF Sample Copy (Including FULL TOC, Graphs, and Tables) of this report @: https://researchcognizance.com/sample-request/896 Top Key Players Profiled in this report are: Novartis, Orphagen Pharmaceuticals, Inc., Corcept Therapeutics The key questions answered in this report: What will be the Market Size and Growth Rate in the forecast year? What are the Key Factors driving Cushing’s Syndrome Diagnostic and Treatment Market? What are the Risks and Challenges in front of the market? Who are the Key Vendors in Cushing’s Syndrome Diagnostic and Treatment Market? What are the Trending Factors influencing the market shares? What are the Key Outcomes of Porter’s five forces model? Which are the Global Opportunities for Expanding the Cushing’s Syndrome Diagnostic and Treatment Market? Various factors are responsible for the market’s growth trajectory, which are studied at length in the report. In addition, the report lists down the restraints that are posing threat to the global Cushing’s Syndrome Diagnostic and Treatment market. It also gauges the bargaining power of suppliers and buyers, threat from new entrants and product substitute, and the degree of competition prevailing in the market. The influence of the latest government guidelines is also analyzed in detail in the report. It studies the Cushing’s Syndrome Diagnostic and Treatment market’s trajectory between forecast periods. Get up to 30% Discount on this Premium Report @: https://researchcognizance.com/discount/896 Regions Covered in the Global Cushing’s Syndrome Diagnostic and Treatment Market Report 2022: • The Middle East and Africa (GCC Countries and Egypt) • North America (the United States, Mexico, and Canada) • South America (Brazil etc.) • Europe (Turkey, Germany, Russia UK, Italy, France, etc.) • Asia-Pacific (Vietnam, China, Malaysia, Japan, Philippines, Korea, Thailand, India, Indonesia, and Australia) The cost analysis of the Global Cushing’s Syndrome Diagnostic and Treatment Market has been performed while keeping in view manufacturing expenses, labor cost, and raw materials and their market concentration rate, suppliers, and price trend. Other factors such as Supply chain, downstream buyers, and sourcing strategy have been assessed to provide a complete and in-depth view of the market. Buyers of the report will also be exposed to a study on market positioning with factors such as target client, brand strategy, and price strategy taken into consideration. The report provides insights on the following pointers: Market Penetration: Comprehensive information on the product portfolios of the top players in the Cushing’s Syndrome Diagnostic and Treatment market. Product Development/Innovation: Detailed insights on the upcoming technologies, R&D activities, and product launches in the market. Competitive Assessment: In-depth assessment of the market strategies, geographic and business segments of the leading players in the market. Market Development: Comprehensive information about emerging markets. This report analyzes the market for various segments across geographies. Market Diversification: Exhaustive information about new products, untapped geographies, recent developments, and investments in the Cushing’s Syndrome Diagnostic and Treatment market. Table of Content Global Cushing’s Syndrome Diagnostic and Treatment Market Research Report Chapter 1: Global Cushing’s Syndrome Diagnostic and Treatment Industry Overview Chapter 2: Global Economic Impact on Cushing’s Syndrome Diagnostic and Treatment Industry Chapter 3: Global Market Competition by Industry Producers Chapter 4: Global Productions, Revenue (Value), according to regions Chapter 5: Global Supplies (Production), Consumption, Export, Import, geographically Chapter 6: Global Productions, Revenue (Value), Price Trend, Product Type Chapter 7: Global Market Analysis, on the basis of Application Chapter 8: Cushing’s Syndrome Diagnostic and Treatment Market Pricing Analysis Chapter 9: Market Chain, Sourcing Strategy, and Downstream Buyers Chapter 10: Strategies and key policies by Distributors/Suppliers/Traders Chapter 11: Key Marketing Strategy Analysis, by Market Vendors Chapter 12: Market Effect Factors Analysis Chapter 13: Global Cushing’s Syndrome Diagnostic and Treatment Market Forecast Buy Exclusive Report @: https://researchcognizance.com/checkout/896/single_user_license If you have any special requirements, please let us know and we will offer you the report as you want. About Us: Research Cognizance is an India-based market research Company, registered in Pune. Research Cognizance aims to provide meticulously researched insights into the market. We offer high-quality consulting services to our clients and help them understand prevailing market opportunities. Our database presents ample statistics and thoroughly analyzed explanations at an affordable price. Contact Us: Neil Thomas 116 West 23rd Street 4th Floor New York City, New York 10011 sales@researchcognizance.com +1 7187154714

An analysis of nationwide data from Sweden provides an overview of the increased risk of death associated with Cushing's disease was present even after biochemical remission. New data from an analysis of patient data over nearly 30 years suggests the increased risk of mortality associated with Cushing’s disease persists even after treatment. A 4:1 matched analysis comparing data from 371 patients with Cushing’s disease with 1484 matched controls, indicated risk of mortality was 5-fold greater among those not in remission compared to matched controls, but even those in remission at the last follow-up were at a 50% greater risk of mortality compared to controls. “To our knowledge, this is the first study that investigated mortality in an unselected cohort of patients treated for Cushing’s disease and followed up in comparison to mortality in matched controls. The mortality rate was more than doubled in patients with Cushing’s disease, and not being in remission was a strong predictor of premature death,” wrote investigators. With a lack of consensus surrounding the impact of biochemical remission on life expectancy in patients with Cushing’s disease, a team of investigators from multiple institutions in Sweden designed their study with the intent of assessing this association with mortality in a time-to-event analysis of an unselected nationwide Cushing’s disease cohort. Using the Swedish Pituitary Registry, investigators identified 371 patients with Cushing’s disease for inclusion in their analysis. The Swedish Pituitary Register is a nationwide registry that collected data on the majority of Swedish patients with Cushing’s disease. For the current study, investigators included all patients with Cushing’s disease from the register diagnosed between May 1991-September 2018 and followed these patients until the date of death, date of emigration, or December 26, 2018. From the register, investigators obtained data related to date of diagnosis, age, sex, treatment, and biochemical remission status evaluations. The median age at diagnosis was 44 (IQR, 32-56) years and the median follow-up was 10.6 (IQR, 5.7-18) years. The remissions rates for the study cohort were 80%, 92%, 96%, 91%, and 97% at the 1-, 5-, 10-, 15- and 20-year follow-ups, respectively. These patients were matched in a 4:1 based on age, sex, and residential area at the diagnosis data, yielding a cohort of 1484 matched controls. Upon analysis, the overall risk of mortality was greater among those with Cushing’s disease compared to the matched controls (HR, 2.1 [95% CI, 1.5-2.8]). Investigators pointed out increased risk was observed among patients in remission at the last follow-up (n=303; HR, 1.5 [95% CI, 1.02-2.2]), those in remission after a single pituitary surgery (n=177; HR, 1.7 [95% CI, 1.03-2.8]), and those not in remission (n=31; HR, 5.6 [95% CI, 2.7-11.6]). Additionally, results indicated cardiovascular disease and infections were the most overrepresented cases of death, accounting for 32 and 12 of the 66 total instances of mortality. “The findings of the present study confirm and complement previous findings of increased overall mortality in Cushing’s disease patients, having a more than doubled HR for death compared to matched controls. Most importantly, an increased HR persisted among patients who had been successfully treated and reached a Cushing’s disease biochemical cure,” investigators added. This study, “Increased mortality persists after treatment of Cushing’s disease: A matched nationwide cohort study,” was published in the Journal of the Endocrine Society. From https://www.endocrinologynetwork.com/view/medicaid-expansion-under-aca-may-have-reduced-rate-of-major-diabetes-related-amputations

Although Dr. Friedman is at the forefront of Cushing’s Disease, he was not invited to be part of the Pituitary Society Consensus Guidelines on Cushing’s Disease published in Lancet Diabetes and Endocrinology in 2021, many of his ideas on Cushing’s Disease that he has been advocating for years were included in the recent guidelines. In this informative webinar, Dr. Friedman will discuss The use of imaging for the diagnosis of Cushing’s Disease The need for multiple testing to diagnose episodic Cushing’s Disease The importance of UFC and salivary cortisol testing The use of medication trial prior to surgery The use of ketoconazole for the medication trial and longer-term treatment Dr. Friedman will also discuss new Cushing’s medications. Sunday • April 3 • 6 PM PST Via Zoom Click here to join the meeting orhttps://us02web.zoom.us/j/4209687343?pwd=amw4UzJLRDhBRXk1cS9ITU02V1pEQT09OR+16699006833,,4209687343#,,,,*111116#Slides will be available on the day of the talk here. You can also click to read the consensus guidelines There will be plenty of time for questions using the chat button. For more information, email us at mail@goodhormonehealth.com

Abstract Corticotroph pituitary adenomas commonly cause Cushing’s disease (CD), but some of them are clinically silent. The reason why they do not cause endocrinological symptoms remains unclear. We used data from small RNA sequencing in adenomas causing CD (n = 28) and silent ones (n = 20) to explore the role of miRNA in hormone secretion and clinical status of the tumors. By comparing miRNA profiles, we identified 19 miRNAs differentially expressed in clinically functioning and silent corticotroph adenomas. The analysis of their putative target genes indicates a role of miRNAs in regulation of the corticosteroid receptors expression. Adenomas causing CD have higher expression of hsa-miR-124-3p and hsa-miR-135-5p and lower expression of their target genes NR3C1 and NR3C2. The role of hsa-miR-124-3p in the regulation of NR3C1 was further validated in vitro using AtT-20/D16v-F2 cells. The cells transfected with miR-124-3p mimics showed lower levels of glucocorticoid receptor expression than control cells while the interaction between miR-124-3p and NR3C1 3′ UTR was confirmed using luciferase reporter assay. The results indicate a relatively small difference in miRNA expression between clinically functioning and silent corticotroph pituitary adenomas. High expression of hsa-miR-124-3p in adenomas causing CD plays a role in the regulation of glucocorticoid receptor level and probably in reducing the effect of negative feedback mediated by corticosteroids. Keywords: neuroendocrine pituitary tumors; Cushing’s disease; silent corticotroph adenoma; miRNA; hsa-miR-124-3p; NR3C1; glucocorticoid receptor 1. Introduction Pituitary adenomas (also referred to as pituitary neuroendocrine tumors, PitNETs) represent about 10–20% of intracranial neoplasms in adults. They may originate from different kinds of secretory pituitary cells including corticotroph ACTH-secreting cells. Corticotroph adenomas commonly cause ACTH-dependent Cushing’s disease, but a significant proportion of these tumors are endocrinologically non-functioning and classified as subclinical/silent corticotroph adenomas (SCAs) [1]. CD-causing ACTH tumors are commonly small microadenomas with approximately 50% being smaller than 5 mm, which is challenging for MRI diagnostics [2]. In contrary, SCAs are commonly diagnosed due to neurological symptoms related to tumor mass at the stage of large macroadenomas. Frequently they show invasive growth and increased proliferation index [1]. According to current recommendations, SCAs are now referred to as “high-risk” pituitary adenomas which refers to their fast and invasive growth, high risk of recurrence and resistance to medical therapy [3,4]. They are recognized to be more aggressive than other clinically nonfunctioning pituitary tumors such as those of gonadotroph origin or null-cell adenomas [5]. The mechanism underlying the difference in secretory activity of CD-causing and subclinical tumors is unclear and only a few studies focused on this issue were published. The results indicated a role of the expression levels of particular genes/proteins involved in the regulation of POMC expression and pro-hormone conversion into ACTH as well as genes involved in pituitary differentiation [6,7,8,9,10,11,12,13]. However, it also appears that both active and silent corticotroph adenomas share a similar overall gene expression profile [14,15]. The aim of this study was to compare the profiles of microRNA (miRNA) expression in clinically functioning and silent corticotroph adenomas and to identify miRNAs that play a role in different ACTH secretory activity. 2. Results 2.1. Patients Characteristics The study included 28 patients with CD and 20 patients suffering from SCA. All patients with CD had clear clinical signs and symptoms of hypercortisolism verified according to biochemical criteria including elevated midnight cortisol levels and 24 h urinary free cortisol (UFC). Patients with SCA had no clinical or biochemical signs of hypercortisolism and showed normal levels of midnight cortisol and 24 h UFC. Patients with CD had significantly higher morning serum cortisol levels than patients with SCAs (p = 0.0002) while no significant difference was observed in the morning serum ACTH levels. No difference in cortisol/ACTH ratio was observed between CD and SCA patients. All the adenoma samples were ACTH-positive upon immunohistochemical staining against pituitary hormones (ACTH, GH, TSH, FSH, LH, α-subunit) and had characteristic ultrastructural features of corticotroph adenoma. Forty-one adenomas were positive only for ACTH, while seven ACTH-positive adenomas showed additional moderate/weak immunoreactivity for α-subunit. Increased proliferation assessed by Ki67 index ≥ 3% was observed in a similar proportion of CD and SCA patients, seven tumors causing CD and five SCAs. A higher proportion of sparsely vs. densely granulated adenomas was observed in SCAs than in CD-related adenomas, but the difference did not cross a significance threshold (p = 0.0787). No difference in the proportion of invasive/noninvasive adenomas was observed in clinically functioning and silent corticotroph adenomas. All SCAs were macroadenomas, while tumors causing CD included 17 macroadenomas and 11 microadenomas. No significant differences in preoperative clinical parameters, including 24 h UFC, morning serum ACTH level, morning and midnight serum cortisol level, cortisol/ACTH ratio, were observed between CD patients with micro- and macroadenomas. Irrespectively, a correlation between tumors size and ACTH level (Spearman R= 0.4678; p = 0.0121) and a negative correlation between cortisol/ACTH ratio (Spearman R= −0.4015; p = 0.0342) was observed in CD patients. No correlation was found between the remaining biochemical parameters and tumor size. Overall, the patients’ characteristics are presented in Table 1, while details including both the clinical and histopathological data are shown in Supplementary Table S1. Table 1. Summary of clinical features of patients with Cushing’s disease and silent corticotroph adenomas. 2.2. Identification of miRNAs Differentially Expressed in Corticotroph Adenomas Causing CD and Subclinical Cortiotroph Adenomas NGS data on miRNA expression of 48 corticotroph adenomas from previous investigation were used to compare miRNA expression levels between adenomas causing CD (n = 24) and subclinical corticotroph adenomas (n = 20). Sequencing of small RNA libraries produced approximately 2,497,367 reads per sample, which were mapped to the human genome (hg19) and used for quantification of expression levels of known miRNAs, according to miRBase 22 release. Sequencing reads were annotated to 1917 miRNAs. Measurements of 1902 mature miRNAs expression were included in the analysis, after filtering out the miRNAs with low expression. When miRNA profiles of adenomas causing CD and SCAs were compared, a total of 19 differentially expressed miRNAs were found that met the criteria of adjusted p-value < 0.05. This set included 16 miRNAs with higher expression in tumors causing CD: hsa-miR-129-2-3p, hsa-miR-129-5p, hsa-miR-124-3p, hsa-miR-132-5p, hsa-miR-129-1-3p, hsa-miR-135b-5p, hsa-miR-27a-3p, hsa-miR-10b-5p, hsa-miR-9-3p, hsa-miR-6506-3p, hsa-miR-6864-5p, hsa-let-7b-5p, hsa-miR-670-3p, hsa-miR-22-5p, hsa-miR-346 and hsa-miR-9-5p, Three miRNAs with lower expression in CD patients were found: hsa-miR-1909-3p, hsa-miR-4319 and hsa-miR-181b-3p. Details are presented in Table 2 and Figure 1A,B. Figure 1. MiRNA expression profiling in corticotroph adenomas. (A). Difference in miRNA expression between functioning and silent corticotroph adenomas. Volcano plot showing differentially expressed miRNAs. Significance and fold change thresholds are marked with dashed lines. (B). Heat map representing the expression of differentially expressed miRNAs and clustering the samples of adenomas causing Cushing’s disease (CD) and silent corticotroph adenomas (SCA). (C). The correlation between the expression levels of differentially expressed miRNAs and POMC expression or hormonal laboratory measurements in patients: morning plasma ACTH level, morning and midnight plasma cortisol levels and 24 h urinary free cortisol; * indicate p-value < 0.05; ** indicate p-value < 0.01; *** indicate p-value < 0.001 Table 2. The list of miRNAs differentially expressed in corticotroph pituitary adenomas causing CD and silent corticotroph adenomas. 2.3. The Correlation of miRNA Expression and Patients’ Clinical Data Since the clustering of the tumors based on the expression of differentially expressed miRNAs did not clearly separate functioning and silent adenomas, we determined whether the expression of the identified differentially expressed miRNAs is directly related to the results of patients’ laboratory tests as well as POMC expression, measured in tumor samples with qRT-PCR. For this purpose, Spearman’s correlation was applied to calculate a correlation matrix. We observed a significant positive correlation between 13 miRNAs out of 19 differentially expressed miRNAs and at least one of clinical laboratory parameters: serum ACTH, morning cortisol level, midnight cortisol level or 24 h UFC. For 11 miRNAs, with higher expression in patients with CD a positive correlation was observed, while a negative correlation was observed for 3 miRNAs that have lower expression in patients with CD. Four of the differentially expressed miRNAs, hsa-miR-9-3p, hsa-miR-9-5p, hsa-miR-27a-3p and hsa-miR-6506-3p, are correlated with POMC expression level in tumor tissue. The absolute value of correlation coefficient ranged between 0.31 and 0.55 which indicates a weak/moderate relationship. Details are presented in Figure 1C. 2.4. Funtional Enrichment Analysis of Differentially Expressed miRNAs To investigate the possible functional role of the identified miRNAs with different expression levels in CD tumors and SCAs, we used the information on experimentally validated miRNA targets gathered in the miRtarbase release 8.0 database. High confidence known miRNA targets that were validated with luciferase reporter assay, reported in miRtarbase, were included in the analysis. The enrichment of the genes reported as miRNA targets of our 19 miRNAs of interest was determined with gene set over-representation analysis (GSOA) based on Gene Ontology (GO) Molecular Function and GO Biological Processes. The list of all the genes reported in miRTarbase as validated with reporter gene assay was used as reference. As a result, we found 30 GO Molecular Function terms and 293 GO Biological Processes terms as significantly enriched with genes that are targets of the 19 differentially expressed miRNAs. Top 10 enriched terms were related mainly to steroid hormone activity, regulation of transcription and regulation of stem cell differentiation, as shown in Figure 2. Details are presented in Supplementary Table S2. We paid special attention to the terms that refer to steroid hormone action, i.e., steroid hormone receptor activity (GO:0003707), nuclear receptor activity (GO:0004879), ligand-activated transcription factor activity (GO:0098531), as well as steroid hormone-mediated signaling pathway (GO:0043401) and hormone-mediated signaling pathway (GO:0009755). Importantly, the miRNA target genes that were overrepresented in these terms included NR3C1 and NR3C2 that encode for adrenal hormones glucocorticoid receptor (GR) and mineralocorticoid receptor (MR), respectively. According to the miRtarbase 9.0 database, hsa-miR-124-3p is a negative regulator of NR3C1 gene [16] while both hsa-miR-124-3p and hsa-miR-135b-5p downregulate MR [17]. Figure 2. Gene set over-representation analysis of putative target genes of miRNAs differentially expressed in clinically functioning and silent corticotroph adenomas. Using the PubMed search, we found additional evidence strongly supporting the role of hsa-miR-124-3p in the regulation of NR3C1 [18,19,20,21] as well as the role of hsa-miR-135b-5p in downregulating NR3C2 [22,23]. 2.5. Comparison of the Expression of NR3C1 and NR3C2 in Corticotroph Adenomas Causing CD and Silent Adenomas We determined the expression levels of NR3C1 and NR3C2 in corticotroph adenomas with qRT-PCR. We observed a significantly lower expression of both genes in samples from CD patients (n = 24) as compared to SCAs (n = 24); fold change (FC) 0.49 p = 0.0166 and FC 0.37 p = 0.0132, for NR3C1 and NR3C2, respectively. However, the observed difference is rather slight and a notable dispersion of the results was observed (Figure 3). The differences in NR3C1 and NR3C2 expression correspond to the differences in hsa-miR-124-3p and hsa-miR-135b-5p levels. Patients with CD have higher levels of both miRNAs and lower levels of NR3C1 and NR3C2 mRNA (Figure 3). Unfortunately, we did not find a direct correlation between the expression levels of hsa-miR-124-3p and NR3C1 or hsa-miR-135b-5p and NR3C2. Figure 3. The expression levels of NR3C1 and NR3C2 measured with qRT-PCR as well as hsa-miR-124-3p and hsa-miR-135b-5p measured with small RNA sequencing in tumor samples from CD patients and silent corticotroph adenomas; * indicate p-value < 0.05 2.6. Investigtion of miRNA-Related Regulation of NR3C1 In Vitro Transfecting the cultured cells with miRNA mimics is the commonly used approach of in vitro validation of specific miRNA–mRNA interaction. We used mice corticotroph tumor AtT-20/D16v-F2 cells for in vitro experiment and initially verified whether these cells do express Nr3c1 and Nr3c2 genes using deposited RNAseq data from a previous experiment on AtT-20 cells (GSE132324; Gene Expression Omnibus) and qRT-PCR. This showed that the AtT-20/D16v-F2 have relatively high expression of Nr3c1 but do not express Nr3c2. Thus, we focused on the regulatory role of miR-124-3p on Nr3c1 expression. We used miRBase [24] and Targetscan [25] to determine whether miR-124-3p is evolutionarily conserved in humans and mice and whether it targets NR3C1 in both species. It confirmed that miR-124-3p is broadly conserved and it shares the same sequence of mature miRNA in humans and mice. Importantly, GR is among highly rated miR-124-3p predicted targets in both humans and mice and two highly conserved miR-124-3p binding motifs in 3′UTR of this gene were identified in these two species (Figure 4A). Figure 4. Role of mir-124-3p in regulation of glucocorticoid receptor gene. (A). Putative hsa-mir-124-3p target sites in 3′UTR of NR3C1. (B). Reduced expression of Nr3c1 gene expression and glucocorticoid receptor (GR) protein level in AtT-20/D16v-F2 cells treated with hsa-miR-124-3p mimics. (C). Results of luciferase reporter gene assay, showing the interaction between Nr3c1 3′UTR site 2 and mir-124-3p; * indicate p-value < 0.05; ns—not significant. When we transfected AtT-20/D16v-F2 cells with miR-124-3p miRNA mimic and unspecific negative control miRNA mimic, we observed a significant decrease in Nr3c1 expression in cells treated with miR-124-3p miRNA mimic (Figure 4B). It was significantly lower than in cells treated with unspecific miRNA mimic. This difference was also clearly visible at the protein level. The GR level was reduced in cells treated with miR-124-3p miRNA mimic as compared to control (Figure 4B). Two fragments of Nr3c1 3′UTR including each of putative miR-124-3p binding motifs were cloned in plasmid vector into 3′ region of the firefly luciferase gene. AtT-20/D16v-F2 cells were transfected with empty vector, vector with miR-124-3p binding site 1 and vector miR-124-3p binding site 2. Each of the three variants of the cells were cotransfected with miR-124-3p miRNA mimic or unspecific miRNA mimic that served as a negative control. Luminescence was developed 48 h after transfection and detected with microplate reader. As a result, we observed a significant decrease in luminescence in the cells with introduced plasmid with miR-124-3p binding site 2 treated with miR-124-3p mimic as compared to the cells transfected with the same plasmid construct but with control miRNA mimic. This observation confirms the interaction between miR-124-3p and 3′ UTR of Nr3c1 at putative binding site 2 (Figure 4C). The experiment did not confirm an interaction between miR-124-3p and 3′ UTR of Nr3c1 at binding site 1 since no significant difference of luminescence was found in cells transfected with plasmid vector harboring this binding motif treated with miR-124-3p mimic and the same cells treated with negative miRNA mimic (Figure 4C). 3. Discussion Based on the clinical manifestation and biochemical tests results, pituitary corticotroph adenomas can be divided into functioning adenomas causing Cushing’s disease and SCAs. These two subtypes of tumors also differ in terms of some characteristics in MRI [2,26] and pathological features [27]. In contrast to CD-causing adenomas which are commonly small microadenomas, SCAs are diagnosed as macroadenomas due to neurological symptoms related to tumor mass. They are characterized by invasive growth, high risk of recurrence and resistance to medical therapy and are therefore referred to as “high-risk” pituitary adenomas according to current classification [3,4]. In our study, the SCAs were larger than functioning counterparts, as expected. A clear prevalence of women is observed among CD patients according to literature data [28], while it is not observed in patients suffering from SCAs. Our SCA group contained near equal representation of women and men as in previous reports [29,30]; however, some studies indicated female prevalence in SCAs [31]. Comparing functioning and silent corticotroph adenomas, we did not observe difference in patients’ age as well as differences in invasive growth status, ratio of adenomas with increased proliferation index and proportions of sparsely and densely granulated adenomas that may suggest the lack of difference in the tumors’ “aggressiveness”. Importantly, limitations for generalization of our results should be noted. The number of patients included in the analysis is relatively low and the group is not representative of the general population, especially in the case of patients suffering from Cushing’s disease. Since the main goal of our study was a molecular profiling of tumor tissue, we intentionally preselected large adenomas, which allowed us to have enough tissue for DNA/RNA isolation and successful molecular procedures. In our investigation, we observed a negative correlation between cortisol/ACTH ratio and tumor volume in functioning corticotroph adenomas as described previously [32]. However, we did not observe any difference between micro- and macroadenomas causing CD as compared to SCAs (data not shown) as was found in previous studies [12]. The reason why some of corticotroph adenomas exhibit excessive hormone secretion and the others remain clinically silent is unclear and only few attempts have been made to determine the possible molecular mechanism underlying this difference in secretory activity. They were mainly focused on investigating the expression of the selected genes or proteins by comparing subclinical and functioning corticotroph adenomas. These studies indicated different expression levels of prohormone convertase 1/3 POMC, genes encoding somatostatin receptors, corticotropin releasing hormone receptor 1, vasopressin receptor (V1BR), corticosteroid 11-beta-dehydrogenase as well as NEUROD1 and TPIT [6,7,8,9,10,11,12,13]. However, whole transcriptome studies indicated that adenomas causing CD and subclinical corticotroph adenomas share a very common gene expression profile and a very low number of differentially expressed genes can be found by comparing transcriptome of silent and CD-causing ACTH tumors [14,15]. In our study, we determined the miRNA expression profile of 28 clinically functioning adenomas and 20 SCAs with next-generation sequencing of small RNA fraction. This allowed for the quantification of over 1900 miRNA annotated to current version of miRbase database and comparing their expression in two groups of tumor samples. We found a significant difference only in the expression levels of 19 miRNAs, that represent less than 1% of the miRNAs included in the analysis. This result resembles the observation from previous comparison of whole transcriptome profiles in functioning adenomas and SCAs where only 34 differentially expressed genes were found. Generally, both observations indicate a very common molecular profile of corticotroph adenomas, regardless of the functional status. In our study, the expression levels of 13 out of 19 identified differentially expressed miRNAs were also correlated with peripheral ACTH/cortisol levels, further supporting the role of these miRNAs in secretory activity of corticotroph adenomas. The possible role of miRNA in subclinical nature of SCAs was addressed in only one previous study by García-Martínez A et al. [33]. The authors compared the expression of 5 miRNAs in 24 functioning and 23 silent adenomas and observed a difference in hsa-miR-200a and hsa-miR-103 levels [33]. Their results were not confirmed by our investigation since these two miRNAs were not found among differentially expressed miRNAs. In our data, very a similar expression level of hsa-miR-200a was observed in clinically functioning and silent adenomas. In turn, a slightly higher expression of hsa-miR-103a-3p was observed in SCAs as previously reported, but the difference did not cross the significance threshold level. We should note that different methods were used for these two studies and technical and analytical differences could result in this discrepancy. Since miRNAs play a role in gene regulation, their effect should be investigated in the context of the function of targeted genes. The interaction between miRNA and its target mRNA 3′UTR can be predicted with in silico tools. Unfortunately, prediction results can be very difficult to interpret since a huge number of predicted interactions can be found for some miRNAs. For example, when using the Targetescan (http://www.targetscan.org; accessed on 28 February 2022) prediction tool [25], over 4000 target genes were predicted for each hsa-miR-9-3p, hsa-miR-1909-3p, hsa-miR-22-5p and hsa-miR-181b-3p that we found as differentially expressed in CD and SCA. Therefore, to investigate a possible functional relevance of differentially expressed miRNAs we used a database of experimentally validated miRNA targets [34]. Gene set over-representation analysis of miRNA target genes indicated their enrichment in the pathways of steroid hormone nuclear receptors functioning. This result indicates that miRNAs that have different expression levels in CD and SCAs play a role in the regulation of expression of genes involved in steroid hormone signaling at hormone receptor level. It is especially interesting since this group of compounds includes adrenal hormones that play a role in the regulation of the hypothalamic–pituitary–adrenal (HPA) axis. The particular enriched miRNA target genes included NR3C1 and NR3C2 that encode for corticosteroid hormone receptors (GR and MR, respectively). Both receptors are located in the cytoplasm where they bind glucocorticoids. Upon ligand binding, they are translocated to nucleus where they form dimers on DNA at glucocorticoid response elements (GREs). Glucocorticoid and mineralocorticoid receptors directly regulate the expression of target genes and/or influence the expression indirectly through the interaction with other transcription factors [35]. Glucocorticoids play a role in the basic mechanism of negative feedback of HPA axis. They act on hypothalamus, where high cortisol levels reduce secretion of corticotropin-releasing hormone (CRH), thus they directly reduce stimulation of ACTH secretion by anterior pituitary lobe. Glucocorticoids also inhibit the activity of pituitary cells indirectly. Corticotroph cells express GRs and their activation results in the reduction of POMC expression and secretion of ACTH [36,37]. In pituitary corticotroph adenomas, NR3C1 point mutations and loss of heterozygosity in NR3C1 locus were identified [38]. These mutations seem to affect the secretory activity and result in tumor resistance to corticosteroids [39]. Reduced expression of corticosteroid receptors in corticotroph adenomas has been reported in patients with resistance to high doses of dexamethasone [40]. These data indicate a role of GR in secretory activity of clinically functioning corticotroph adenomas. The expression of corticosteroid genes was previously investigated in CD-causing tumors and SCAs and no significant differences were found. However, it is worth noting that a low number of SCA patients was included in these studies: n = 9 [13], n = 8 [11] and n = 2 [41]. According to previously published results, hsa-miR-124-3p is a negative regulator of NR3C1 [16,18,19,20,21]. This was observed in acute lymphoblastic leukemia [19], adipocytes [20] and human embryonic kidney cells [21], where the reduced expression of NR3C1 upon an increase in hsa-miR-124-3p as well as a direct interaction between this miRNA and 3′UTR of GR gene were observed. Some additional clinical observations also suggest the role of hsa-miR-124-3p in the regulation of the response to cortiosteroids in patients with acute-on-chronic liver failure [18] and lymphoblastic leukemia [19]. Hsa-miRNA-124 also mediates corticosteroid resistance in T-cells of sepsis patients through the downregulation of GR [42]. Our analysis of the expression level of NR3C1 in corticotroph adenomas showed that tumors causing CD have lower gene expression and accordingly they exhibit higher levels of hsa-miR-124-3p. Subsequently, the role of hsa-miR-124-3p in NR3C1 downregulation was confirmed in mice AtT-20/D16v-F2 corticotroph cells using miRNA mimics and reporter gene assay. Transfection of AtT-20/D16v-F2 cells with hsa-miR-124-3p mimics resulted in reduced NR3C1 mRNA expression and GR protein level. We also confirmed the interaction between hsa-miR-124-3p and one of two predicted binding motifs in 3′UTR of NR3C1 with luciferase reporter gene assay. Since sequences of hsa-miR-124-3p and target sequence in 3′UTR of NR3C1 mRNA are the same in mice and in humans, we believe that results showing the regulation of the GR-encoding gene in mice AtT-20/D16v-F2 cells are also relevant to humans. Together, the available data indicate that in pituitary corticotrophs, hsa-miR-124-3p downregulates the expression of the GR gene. Since this receptor mediates the response of pituitary cells to cortisol, the expression of hsa-miR-124-3p appears to be an important element in the regulation of secretory activity of corticotroph cells. Based on these results, we can hypothesize that in CD, a high level of hsa-miR-124-3p contributes to lowering of GR expression and in consequence it plays a role in lowering the effect of glucocorticoid feedback on the activity of corticotroph adenoma. Hsa-miR-124-3p and hsa-miR-135b-5p can downregulate the expression level of MR, as proven in model HeLa cells [17]. Expression of both miRNAs is higher in corticotroph adenomas causing CD which corresponds to the lower expression of the NR3C2 gene in these tumors as compared to SCAs. Since the role of the MR receptor expression in pituitary cells is poorly understood, the functional implication of this observation is much less clear than in the case of GR downregulation. MR and GR have similar amino acid sequences, especially in DNA-binding domain, but they differ in affinity to corticosteroids. MR is specific for both mineralocorticoids and glucocorticoids while GR is specific predominantly for glucocorticoids. MRs have much higher affinity for glucocorticoids than GRs and are activated at basal glucocorticoid conditions, while GR occupancy is increased when glucocorticoid levels rise during the circadian peak or stress. Due to these differences, these two receptors play slightly different roles, despite the fact that they share a number of target genes [43]. MR expression is considered more tissue-specific than GR and was reported to be the most prevalent in kidney and adipose tissue but also in the hippocampus and hypothalamus [44]. However, the available databases of human expression pattern such as the Genotype-Tissue Expression project (https://gtexportal.org; accessed on 10 December 2021) or Protein atlas (https://www.proteinatlas.org; accessed on 10 December 2021) indicate that MR is widely expressed in multiple human tissues and organs including the pituitary gland. Unfortunately, a role of MR receptor in pathogenesis of pituitary tumors remains unknown. AtT-20 cells, which are the only available cell line model of corticotroph adenoma, do not express MR receptor, thus the procedure of experimental validation of the role of miRNA in NR3C2 silencing is not applicable. With a lack of experimental data on the exact role of MR, we can only hypothesize that miRNA-mediated silencing of NR3C2 may have the similar effect on HPA axis feedback as silencing of NR3C1. It may enhance ACTH secretion by reducing the direct inhibitory effect of glucocorticoids on neoplastic pituitary corticotrophs. The difference in expression of hsa-miR-124-3p and hsa-miR-135b-5p between subclinical and CD-causing adenomas is not big, thus we suppose that high expression of these miRNAs is not the only cause of difference in ACTH secretion. Presumably this is one of the mechanisms in the regulation of corticotrophs’ secretory activity. The model of miRNA-based corticosteroid receptor regulation does not undermine the role of previously described differences in the expression of convertase 1/3, POMC, somatostatin receptors or corticotropin releasing hormone receptor 1 or genes involved in differentiation of pituitary cells [6,7,8,9,10,11,12,13]. When considering the complex nature of the regulation of ACTH secretion, it can be assumed that multiple mechanisms may be involved in the silent character of subclinical adenomas. The low number of identified differentially expressed miRNAs or genes in silent and clinically functioning adenomas probably results from the intertumoral molecular heterogeneity of SCAs. This is also in line with clinical evidence indicating that some silent corticotroph adenomas can transform into clinically functioning ones while the others remain silent [1]. The misregulation of GR expression or NR3C1 mutation may have important therapeutical implications in CD patients. Non-selective GR antagonist Mifepristone was officially approved for treatment in patients with Cushing’s syndrome [45] while another new GR inhibitor, Relacorilant (CORT125134), is under clinical investigation for its use in this group of patients [46]. The further studies will be required to assess the role of GR abnormalities in response to GR-targeting treatment in CD. In our study, we focused mainly on the role of hsa-miR-124-3p and hsa-miR-135b-5p in the regulation of corticosteroid receptors, but the role of other differentially expressed miRNAs can also be elucidated, based on the function of putative target genes. In the pathways enrichment analysis of the putative targets, molecular functions related to transcriptional regulation were found among the top processes. Interestingly, five miRNAs, i.e., hsa-miR-132-5p, hsa-miR-135b-5p, hsa-miR-27a-3p, hsa-miR-9-3p and hsa-miR-9-5p, were previously reported to downregulate the expression of FOXO1 transcription factor [47,48,49,50,51]. FOXO1 plays an important role in the differentiation of pituitary cells [52] and secretion of gonadotropic hormones [53,54] and prolactin [55]. The role of FOXO1 in pituitary corticotroph cells was not investigated but it was shown to regulate POMC expression in POMC hypothalamic neurons [56]. In POMC, neurons of arcuate nucleus FOXO1 directly suppresses POMC expression. A similar mechanism was also observed in prolactin pituitary adenomas where FOXO1 suppresses the promoter of PRL gene [55]. It is possible that high expression of hsa-miR-132-5p, hsa-miR-135b-5p, hsa-miR-27a-3p, hsa-miR-9-3p and hsa-miR-9-5p in pituitary corticotroph adenomas reduces the level of FOXO1 and eventually contributes to the upregulation of POMC expression. In our data from corticotroph adenomas, we observed the correlation between levels of hsa-miR-9-3p/hsa-miR-9-5 and POMC expression, which also supports this concept, but the exact role of miRNAs in possible FOXO1-related regulation of secretory activity of corticotroph cells requires further functional investigation. 4. Materials and Methods 4.1. Patients and Tissue Samples Pituitary tumor samples from 48 patients were collected during transsphenoidal surgery. Formalin-fixed and paraffin-embedded (FFPE) tissue samples, including 28 samples from patients with Cushing’s disease and 20 samples of SCA were used for the study. Diagnosis of hypercortisolism was based on standard hormonal criteria: increased UFC in three 24 h urine collections, disturbances of cortisol circadian rhythm, increased serum cortisol levels accompanied by increased or not suppressed plasma ACTH levels at 8.00 and a lack of suppression of serum cortisol levels to <1.8 µg/dL during an overnight dexamethasone suppression test (1 mg at midnight). The pituitary etiology of Cushing’s disease was confirmed based on the serum cortisol levels or UFC suppression < 50% with a high-dose dexamethasone suppression test (2 mg q.i.d. for 48 h) or a positive result of a corticotrophin-releasing hormone stimulation test (100 mg i.v.) and positive pituitary magnetic resonance imaging. ACTH levels were assessed using IRMA (ELSA-ACTH, CIS Bio International, Gif-sur-Yvette Cedex, France). The analytical sensitivity was 2 pg/mL (reference range: 10–60 pg/mL). Serum cortisol concentrations were determined by the Elecsys 2010 electrochemiluminescence immunoassay (Roche Diagnostics, Mannheim, Germany). Sensitivity of the assay was 0.02 μg/dL (reference range: 6.2–19.4 μg/dL). UFC was determined after extraction (liquid/liquid with dichloromethane) by electrochemiluminescence immunoassay (Elecsys 2010, Roche Diagnostics)—reference range: 4.3–176 μg/24 h. All the tumors underwent detailed histopathological diagnosis including immunohistochemical staining with antibodies against particular pituitary hormones (ACTH, GH, TSH, FSH, LH, α-subunit) and Ki67 as well as ultrastructural analysis with electron microscopy. The SCAs were characterized by the following clinicopathological criteria: positive immunohistochemical staining for ACTH, lack of signs and symptoms of hypercortisolism (Cushing’s syndrome), negative hormonal evaluation and non-compliance with diagnostic criteria of the CD. Macroadenoma was defined as an adenoma with at least one diameter exceeding 10 mm, and the tumor volume was assessed with the diChiro Nelson formula (height × length × width × π/6). Invasive growth of the tumors was evaluated using Knosp grading [57]. Adenomas with Knosp grades 0, 1 and 2 were considered non-invasive, while those with Knosp 3 and 4 were considered invasive. Forty-three patients had a clear history of not using any drugs that control the overproduction of the cortisol or ACTH (ketoconazole, mitotane, metyrapone, osilodrostat, mifepristone, pasireotide) before surgical treatment. The information on preoperative pharmacological treatment was not available for 5 patients. Tumor tissue content of each FFPE sample ranged between 80 and 100% (median 99%), as assessed with histopathological examination. Patients’ characteristics are presented in Table 1 and details on each patient’s data are available in Supplementary Table S1. The study was approved by the local Ethics Committee of Maria Sklodowska-Curie National Research Institute of Oncology in Warsaw, Poland. Each patient provided informed consent for the use of tissue samples for scientific purposes. Total RNA from FFPE samples was purified with RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE tissue (Thermo Fisher Scientific, Waltham, MA, USA) and measured using NanoDrop 2000 (Thermo Fisher Scientific). RNA was stored at −70 °C. 4.2. Micro RNA Expression Profiling For comparing the miRNA expression profiles in CD-causing and clinically silent adenomas, NGS data from our previous investigation of miRNA expression in corticotroph adenomas were used. The dataset is available at Gene Expression Omnibus, accession no GSE166279. Sequencing of small RNA fraction was performed in 48 tumor samples (28 CD patients and 20 SCA patients) with ion semiconductor sequencing technology, as described previously [58]. Briefly, Ion Total RNA-Seq Kit v2 (Thermo Fisher Scientific) was used for sequencing library construction, Ion Xpress™ RNA-Seq Barcode Kit was used for hybridization and ligation of RNA adapters. RNA reverse transcription and subsequent cDNA purification and library size selection were performed using Nucleic Acid Binding Beads and verified using Bioanalyzer 2100 with High Sensitivity DNA Kit (Agilent, Santa Clara, CA, USA). Ion Chef instrument, with Ion PI™ Hi-Q™ Chef Kit (Thermo Fisher Scientific) and Ion Proton sequencer (Thermo Fisher Scientific) were used for library preparation and sequencing, respectively. BamToFastq package was applied for converting unmapped bam files into fastq files. miRDeep2 was applied for read mapping to known human miRNAs (according to miRBase release 22) and reads quantification. Data normalization and differential expression analysis were performed using DESeq2. Filtration for low-expression miRNAs was applied as described previously. FC of expression calculated as the ratio of the normalized read-count value in CD-causing and silent adenomas was used as a measure of expression difference. Adjusted p-value < 0.05 was used as significance threshold. MiRtarbase release 9.0 database [34] was used to identify known miRNA target genes. PANTHER (http://pantherdb.org; accessed on 10 December 2021) [59] was used for gene set over-representation analysis. 4.3. qRT-PCR gene Expression Analysis One microgram of RNA was subjected to reverse transcription with Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics). qRT-PCR reaction was carried out in 384-well format using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) in a volume of 5 μL, containing 2.25 pmol of each primer. The samples were amplified in triplicates. GAPDH was used as reference gene. Delta Ct method was used to calculate the relative expression level. PCR primers’ sequences are presented in Supplementary Table S3. 4.4. Cell Line Culture and miRNA Mimic Transfection AtT-20/D16v-F2 cells were purchased from ATCC collection and cultured in DMEM medium supplemented with 10% FBS, as recommended. MiRCURY LNA miRNA Mimics including hsa-miR-124-3p mimic (YM00471256, Qiagen, Hilden, Germany) and negative control mimic (YM00479902-ADB, Qiagen) were used. AtT-20/D16v-F2 cells were seeded at 5 × 104 per well of a 24-well plate in culture medium and transfected with 50 nM miRNA with 1% (v/v) HiPerFect Transfection Reagent (Qiagen), according to the manufacturer’s instructions. The next day, the culture medium was changed. In total, 48 h after transfection the cells were harvested and subjected to isolation of total RNA with RNeasy Mini Kit (Qiagen). The expression of the putative hsa-miR-124-3p target gene was determined with qRT-PCR. 4.5. Luciferase Reporter Gene Assay Hsa-miR-124-3p target sites in 3′UTR of NR3C1 were determined with Targetscan [25]. Each of two predicted hsa-miR-124-3p target sites were cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA). AtT-20/D16v-F2 cells (2 × 104/well) were seeded onto a 96-well plate in 100 µL culture medium. The next day, the cells were transfected with 100 ng of each plasmid vector, independently using 0.25% (v/v) lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) in 10 µL of DMEM. The cells were subsequently transfected with either hsa-miR-124-3p mimic (YM00471256, Qiagen) or negative control mimic (YM00479902-ADB, Qiagen) in a final concentration of 50 nM using HiPerfectReagent (Qiagen). Culture medium was changed on the next day. Luciferase activity was measured with One-Glo Luciferase Assay System (Promega) 48 h after transfection. 4.6. Western Blotting Cells were lysed in ice cold RIPA buffer, incubated for 30 min in 4 °C and centrifuged at 12,500× g rpm for 20 min at 4 °C. Samples were resolved using SDS-PAGE and electrotransferred to polyvinylidene fluoride membranes (PVDF) (Thermo Fisher). GR protein was detected with monoclonal anti-Glucocorticoid Receptor antibody (ab183127, Abcam, Cambridge, UK), and secondary anti-rabbit antibody conjugated to HRP (#7074, Cell Signaling, Beverly, MA, USA). Glyceraldehyde-3-Phosphate Dehydrogenase (#MAB374, Millipore, Bedford, MA, USA) detected with mouse HRP-conjugated antibody (#7076 Cell Signaling) served as control. Visualization was performed with SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) and CCD digital imaging system Alliance Mini HD4 (UVItec Limited, Cambridge, UK). 4.7. Statistical Analysis A two-sided Mann–Whitney U-test was used for analysis of continuous variables. The Spearman correlation method was used for correlation analysis. Significance threshold of α = 0.05 was adopted. Data were analyzed using GraphPad Prism 6.07 (GraphPad Software, La Jolla, CA, USA). Hierarchical clustering analysis was carried out with Cluster 3.0, and the results were visualized using TreeView 1.6 software (Stanford University School of Medicine, Stanford, CA, USA). Supplementary Materials The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23052867/s1. Author Contributions Conceptualization, M.M. and M.B.; Methodology, M.B. and B.J.M.; Software, J.B.; Formal analysis, P.K., B.J.M. and M.B.; Investigation, B.J.M., P.K., N.R., M.B. and M.P.; Resources, J.K., G.Z., A.S. and T.M.; Data curation, J.B., B.J.M. and M.B.; Writing—original draft preparation, M.B., P.K. and B.J.M.; Writing—review and editing, all the authors; Visualization, M.B. and B.J.M.; Supervision, M.M.; Project administration M.B.; Funding acquisition, M.M. All authors have read and agreed to the published version of the manuscript. Funding This research was funded by National Science Centre, Poland, grant number 2021/05/X/NZ5/01874. Institutional Review Board Statement The study was conducted in accordance with the Declaration of Helsinki, and approved by the local Ethics Committee of Maria Sklodowska-Curie Institute—Oncology Center in Warsaw, Poland; approval no. number 44/2018, date of approval 26 July 2018. Informed Consent Statement Informed consent was obtained from all subjects involved in the study. Data Availability Statement Data from next-generation sequencing of small RNA fraction of 48 corticotroph adenoma samples are available at Gene Expression Omnibus, accession no GSE166279. Conflicts of Interest The authors declare no conflict of interest. References Ben-Shlomo, A.; Cooper, O. Silent Corticotroph Adenomas. Pituitary 2018, 21, 183–193. [Google Scholar] [CrossRef] [PubMed] Vitale, G.; Tortora, F.; Baldelli, R.; Cocchiara, F.; Paragliola, R.M.; Sbardella, E.; Simeoli, C.; Caranci, F.; Pivonello, R.; Colao, A. Pituitary Magnetic Resonance Imaging in Cushing’s Disease. Endocrine 2017, 55, 691–696. [Google Scholar] [CrossRef] [PubMed] Kontogeorgos, G.; Thodou, E.; Osamura, R.Y.; Lloyd, R.V. High-Risk Pituitary Adenomas and Strategies for Predicting Response to Treatment. Hormones 2022, 1, 3. [Google Scholar] [CrossRef] [PubMed] Osamura, R.Y.; Grossman, A.; Korbonits, M.; Kovacs, K.; Lopes, M.B.S.; Matsuno, A.; Trouillas, J. WHO Classification of Tumours of Endocrine Organs, 4th ed.; Lloyd, R.V., Osamura, R.Y., Rosari, J., Eds.; IARC Press: Lyon, France, 2017. [Google Scholar] Jiang, S.; Chen, X.; Wu, Y.; Wang, R.; Bao, X. An Update on Silent Corticotroph Adenomas: Diagnosis, Mechanisms, Clinical Features, and Management. Cancers 2021, 13, 6134. [Google Scholar] [CrossRef] Tateno, T.; Kato, M.; Tani, Y.; Oyama, K.; Yamada, S.; Hirata, Y. Differential Expression of Somatostatin and Dopamine Receptor Subtype Genes in Adrenocorticotropin (ACTH)- Secreting Pituitary Tumors and Silent Corticotroph Adenomas. Endocr. J. 2009, 56, 579–584. [Google Scholar] [CrossRef] Gabalec, F.; Beranek, M.; Netuka, D.; Masopust, V.; Nahlovsky, J.; Cesak, T.; Marek, J.; Cap, J. Dopamine 2 Receptor Expression in Various Pathological Types of Clinically Non-Functioning Pituitary Adenomas. Pituitary 2012, 15, 222–226. [Google Scholar] [CrossRef] Righi, A.; Faustini-Fustini, M.; Morandi, L.; Monti, V.; Asioli, S.; Mazzatenta, D.; Bacci, A.; Foschini, M.P. The Changing Faces of Corticotroph Cell Adenomas: The Role of Prohormone Convertase 1/3. Endocrine 2017, 56, 286–297. [Google Scholar] [CrossRef] Ohta, S.; Nishizawa, S.; Oki, Y.; Yokoyama, T.; Namba, H. Significance of Absent Prohormone Convertase 1/3 in Inducing Clinically Silent Corticotroph Pituitary Adenoma of Subtype I—Immunohistochemical Study. Pituitary 2002, 5, 221–223. [Google Scholar] [CrossRef] Tateno, T.; Izumiyama, H.; Doi, M.; Akashi, T.; Ohno, K.; Hirata, Y. Defective Expression of Prohormone Convertase 1/3 in Silent Corticotroph Adenoma. Endocr. J. 2007, 54, 777–782. [Google Scholar] [CrossRef] Tateno, T.; Izumiyama, H.; Doi, M.; Yoshimoto, T.; Shichiri, M.; Inoshita, N.; Oyama, K.; Yamada, S.; Hirata, Y. Differential Gene Expression in ACTH -Secreting and Non-Functioning Pituitary Tumors. Eur. J. Endocrinol. 2007, 157, 717–724. [Google Scholar] [CrossRef] Nagaya, T.; Seo, H.; Kuwayama, A.; Sakurai, T.; Tsukamoto, N.; Nakane, T.; Sugita, K.; Matsui, N. Pro-Opiomelanocortin Gene Expression in Silent Corticotroph-Cell Adenoma and Cushing’s Disease. J. Neurosurg. 1990, 72, 262–267. [Google Scholar] [CrossRef] [PubMed] Raverot, G.; Wierinckx, A.; Jouanneau, E.; Auger, C.; Borson-Chazot, F.; Lachuer, J.; Pugeat, M.; Trouillas, J. Clinical, Hormonal and Molecular Characterization of Pituitary ACTH Adenomas without (Silent Corticotroph Adenomas) and with Cushing’s Disease. Eur. J. Endocrinol. 2010, 163, 35–43. [Google Scholar] [CrossRef] [PubMed] Neou, M.; Villa, C.; Armignacco, R.; Jouinot, A.; Raffin-Sanson, M.L.; Septier, A.; Letourneur, F.; Diry, S.; Diedisheim, M.; Izac, B.; et al. Pangenomic Classification of Pituitary Neuroendocrine Tumors. Cancer Cell 2020, 37, 123–134.e5. [Google Scholar] [CrossRef] [PubMed] Bujko, M.; Kober, P.; Boresowicz, J.; Rusetska, N.; Paziewska, A.; Dabrowska, M.; Piaścik, A.; Pȩkul, M.; Zieliński, G.; Kunicki, J.; et al. USP8 Mutations in Corticotroph Adenomas Determine a Distinct Gene Expression Profile Irrespective of Functional Tumour Status. Eur. J. Endocrinol. 2019, 181, 615–627. [Google Scholar] [CrossRef] Vreugdenhil, E.; Verissimo, C.S.L.; Mariman, R.; Kamphorst, J.T.; Barbosa, J.S.; Zweers, T.; Champagne, D.L.; Schouten, T.; Meijer, O.C.; De Ron Kloet, E.; et al. MicroRNA 18 and 124a Down-Regulate the Glucocorticoid Receptor: Implications for Glucocorticoid Responsiveness in the Brain. Endocrinology 2009, 150, 2220–2228. [Google Scholar] [CrossRef] Sõber, S.; Laan, M.; Annilo, T. MicroRNAs MiR-124 and MiR-135a Are Potential Regulators of the Mineralocorticoid Receptor Gene (NR3C2) Expression. Biochem. Biophys. Res. Commun. 2010, 391, 727–732. [Google Scholar] [CrossRef] Wang, X.; Xu, H.; Wang, Y.; Shen, C.; Ma, L.; Zhao, C. MicroRNA-124a Contributes to Glucocorticoid Resistance in Acute-on-Chronic Liver Failure by Negatively Regulating Glucocorticoid Receptor Alpha. Ann. Hepatol. 2020, 19, 214–221. [Google Scholar] [CrossRef] Liang, Y.N.; Tang, Y.L.; Ke, Z.Y.; Chen, Y.Q.; Luo, X.Q.; Zhang, H.; Huang, L. Bin MiR-124 Contributes to Glucocorticoid Resistance in Acute Lymphoblastic Leukemia by Promoting Proliferation, Inhibiting Apoptosis and Targeting the Glucocorticoid Receptor. J. Steroid Biochem. Mol. Biol. 2017, 172, 62–68. [Google Scholar] [CrossRef] Liu, K.; Zhang, X.; Wei, W.; Liu, X.; Tian, Y.; Han, H.; Zhang, L.; Wu, W.; Chen, J. Myostatin/Smad4 Signaling-Mediated Regulation of Mir-124-3p Represses Glucocorticoid Receptor Expression and Inhibits Adipocyte Differentiation. Am. J. Physiol. Endocrinol. Metab. 2019, 316, E635–E645. [Google Scholar] [CrossRef] Roy, B.; Dunbar, M.; Shelton, R.C.; Dwivedi, Y. Identification of MicroRNA-124-3p as a Putative Epigenetic Signature of Major Depressive Disorder. Neuropsychopharmacology 2017, 42, 864–875. [Google Scholar] [CrossRef] Zhang, Z.; Che, X.; Yang, N.; Bai, Z.; Wu, Y.; Zhao, L.; Pei, H. MiR-135b-5p Promotes Migration, Invasion and EMT of Pancreatic Cancer Cells by Targeting NR3C2. Biomed. Pharmacother. 2017, 96, 1341–1348. [Google Scholar] [CrossRef] [PubMed] Huang, Y.; Wang, Y.; Ouyang, Y. Elevated MicroRNA-135b-5p Relieves Neuronal Injury and Inflammation in Post-Stroke Cognitive Impairment by Targeting NR3C2. Int. J. Neurosci. 2021, 132, 58–66. [Google Scholar] [CrossRef] [PubMed] Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. MiRBase: From MicroRNA Sequences to Function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef] [PubMed] McGeary, S.E.; Lin, K.S.; Shi, C.Y.; Pham, T.M.; Bisaria, N.; Kelley, G.M.; Bartel, D.P. The Biochemical Basis of MicroRNA Targeting Efficacy. Science 2019, 366, eaav1741. [Google Scholar] [CrossRef] [PubMed] Kasuki, L.; Antunes, X.; Coelho, M.C.A.; Lamback, E.B.; Galvão, S.; Silva Camacho, A.H.; Chimelli, L.; Ventura, N.; Gadelha, M.R. Accuracy of Microcystic Aspect on T2-Weighted MRI for the Diagnosis of Silent Corticotroph Adenomas. Clin. Endocrinol. 2020, 92, 145–149. [Google Scholar] [CrossRef] [PubMed] Thodou, E.; Argyrakos, T.; Kontogeorgos, G. Galectin-3 as a Marker Distinguishing Functioning from Silent Corticotroph Adenomas. Hormones 2007, 6, 227–232. [Google Scholar] Valassi, E.; Santos, A.; Yaneva, M.; Tóth, M.; Strasburger, C.J.; Chanson, P.; Wass, J.A.H.; Chabre, O.; Pfeifer, M.; Feelders, R.A.; et al. The European Registry on Cushing’s Syndrome: 2-Year Experience. Baseline Demographic and Clinical Characteristics. Eur. J. Endocrinol. 2011, 165, 383–392. [Google Scholar] [CrossRef] Langlois, F.; Shao, D.; Lim, T.; Yedinak, C.G.; Cetas, I.; Mccartney, S.; Cetas, J.; Dogan, A.; Fleseriu, M. Predictors of Silent Corticotroph Adenoma Recurrence; a Large Retrospective Single Center Study and Systematic Literature Review. Pituitary 2018, 21, 32–40. [Google Scholar] [CrossRef] Jahangiri, A.; Wagner, J.R.; Pekmezci, M.; Hiniker, A.; Chang, E.F.; Kunwar, S.; Blevins, L.; Aghi, M.K. A Comprehensive Long-Term Retrospective Analysis of Silent Corticotrophic Adenomas vs Hormone-Negative Adenomas. Neurosurgery 2013, 73, 8–17. [Google Scholar] [CrossRef] Strickland, B.A.; Shahrestani, S.; Briggs, R.G.; Jackanich, A.; Tavakol, S.; Hurth, K.; Shiroishi, M.S.; Liu, C.-S.J.; Carmichael, J.D.; Weiss, M.; et al. Silent Corticotroph Pituitary Adenomas: Clinical Characteristics, Long-Term Outcomes, and Management of Disease Recurrence. J. Neurosurg. 2021, 135, 1–8. [Google Scholar] [CrossRef] Machado, M.C.; Alcantara, A.E.E.; Pereira, A.C.L.; Cescato, V.A.S.; Castro Musolino, N.R.; de Mendonça, B.B.; Bronstein, M.D.; Fragoso, M.C.B.V. Negative Correlation between Tumour Size and Cortisol/ ACTH Ratios in Patients with Cushing’s Disease Harbouring Microadenomas or Macroadenomas. J. Endocrinol. Invest. 2016, 39, 1401–1409. [Google Scholar] [CrossRef] [PubMed] García-Martínez, A.; Fuentes-Fayos, A.C.; Fajardo, C.; Lamas, C.; Cámara, R.; López-Muñoz, B.; Aranda, I.; Luque, R.M.; Picó, A. Differential Expression of MicroRNAs in Silent and Functioning Corticotroph Tumors. J. Clin. Med. 2020, 9, 1838. [Google Scholar] [CrossRef] [PubMed] Huang, H.Y.; Lin, Y.C.D.; Li, J.; Huang, K.Y.; Shrestha, S.; Hong, H.C.; Tang, Y.; Chen, Y.G.; Jin, C.N.; Yu, Y.; et al. MiRTarBase 2020: Updates to the Experimentally Validated MicroRNA-Target Interaction Database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef] [PubMed] Koning, A.S.C.A.M.; Buurstede, J.C.; van Weert, L.T.C.M.; Meijer, O.C. Glucocorticoid and Mineralocorticoid Receptors in the Brain: A Transcriptional Perspective. J. Endocr. Soc. 2019, 3, 1917–1930. [Google Scholar] [CrossRef] Nakai, Y.; Usui, T.; Tsukada, T.; Takahashi, H.; Fukata, J.; Fukushima, M.; Senoo, K.; Imura, H. Molecular Mechanisms of Glucocorticoid Inhibition of Human Proopiomelanocortin Gene Transcription. J. Steroid Biochem. Mol. Biol. 1991, 40, 301–306. [Google Scholar] [CrossRef] Drouin, J.; Charron, J.; Gagner, J.-P.; Jeannotte, L.; Nemer, M.; Plante, R.K.; Wrange, Ö. Pro-opiomelanocortin Gene: A Model for Negative Regulation of Transcription by Glucocorticoids. J. Cell. Biochem. 1987, 35, 293–304. [Google Scholar] [CrossRef] Huizenga, N.A.T.M.; De Lange, P.; Koper, J.W.; Clayton, R.N.; Farrell, W.E.; Van Der Lely, A.J.; Brinkmann, A.O.; De Jong, F.H.; Lamberts, S.W.J. Human Adrenocorticotropin-Secreting Pituitary Adenomas Show Frequent Loss of Heterozygosity at the Glucocorticoid Receptor Gene Locus. J. Clin. Endocrinol. Metab. 1998, 83, 917–921. [Google Scholar] [CrossRef] Miao, H.; Liu, Y.; Lu, L.; Gong, F.; Wang, L.; Duan, L.; Yao, Y.; Wang, R.; Chen, S.; Mao, X.; et al. Effect of 3 NR3C1 Mutations in the Pathogenesis of Pituitary ACTH Adenoma. Endocrinology 2021, 162, bqab167. [Google Scholar] [CrossRef] Mu, Y.M.; Takayanagi, R.; Imasaki, K.; Ohe, K.; Ikuyama, S.; Yanase, T.; Nawata, H. Low Level of Glucocorticoid Receptor Messenger Ribonucleic Acid in Pituitary Adenomas Manifesting Cushing’s Disease with Resistance to a High Dose-Dexamethasone Suppression Test. Clin. Endocrinol. 1998, 49, 301–306. [Google Scholar] [CrossRef] Ebisawa, T.; Tojo, K.; Tajima, N.; Kamio, M.; Oki, Y.; Ono, K.; Sasano, H. Immunohistochemical Analysis of 11-β-Hydroxysteroid Dehydrogenase Type 2 and Glucocorticoid Receptor in Subclinical Cushing’s Disease Due to Pituitary Macroadenoma. Endocr. Pathol. 2008, 19, 252–260. [Google Scholar] [CrossRef] Ledderose, C.; Möhnle, P.; Limbeck, E.; Schütz, S.; Weis, F.; Rink, J.; Briegel, J.; Kreth, S. Corticosteroid Resistance in Sepsis Is Influenced by MicroRNA-124-Induced Downregulation of Glucocorticoid Receptor-α. Crit. Care Med. 2012, 40, 2745–2753. [Google Scholar] [CrossRef] [PubMed] Spencer, R.L.; Deak, T. A Users Guide to HPA Axis Research. Physiol. Behav. 2017, 178, 43–65. [Google Scholar] [CrossRef] [PubMed] Han, F.; Ozawa, H.; Matsuda, K.I.; Nishi, M.; Kawata, M. Colocalization of Mineralocorticoid Receptor and Glucocorticoid Receptor in the Hippocampus and Hypothalamus. Neurosci. Res. 2005, 51, 371–381. [Google Scholar] [CrossRef] Castinetti, F.; Fassnacht, M.; Johanssen, S.; Terzolo, M.; Bouchard, P.; Chanson, P.; Cao, D.; Morange, I.; Picó, A.; Ouzounian, S.; et al. Merits and Pitfalls of Mifepristone in Cushing’s Syndrome. Eur. J. Endocrinol. 2009, 160, 1003–1010. [Google Scholar] [CrossRef] [PubMed] Fleseriu, M.; Laws, E.R.; Witek, P.; Pivonello, R.; Ferrigno, R.; de Martino, M.C.; Simeoli, C.; di Paola, N.; Pivonello, C.; Barba, L.; et al. Medical Treatment of Cushing’s Disease: An Overview of the Current and Recent Clinical Trials. Front. Endocrinol. 2020, 11, 648. [Google Scholar] [CrossRef] Senyuk, V.; Zhang, Y.; Liu, Y.; Ming, M.; Premanand, K.; Zhou, L.; Chen, P.; Chen, J.; Rowley, J.D.; Nucifora, G.; et al. Critical Role of MiR-9 in Myelopoiesis and EVI1-Induced Leukemogenesis. Proc. Natl. Acad. Sci. USA 2013, 110, 5594–5599. [Google Scholar] [CrossRef] [PubMed] Liu, D.Z.; Chang, B.; Li, X.D.; Zhang, Q.H.; Zou, Y.H. MicroRNA-9 Promotes the Proliferation, Migration, and Invasion of Breast Cancer Cells via down-Regulating FOXO1. Clin. Transl. Oncol. 2017, 19, 1133–1140. [Google Scholar] [CrossRef] [PubMed] Guttilla, I.K.; White, B.A. Coordinate Regulation of FOXO1 by MiR-27a, MiR-96, and MiR-182 in Breast Cancer Cells. J. Biol. Chem. 2009, 284. [Google Scholar] [CrossRef] Xu, Y.; Zhao, S.; Cui, M.; Wang, Q. Down-Regulation of MicroRNA-135b Inhibited Growth of Cervical Cancer Cells by Targeting FOXO1. Int. J. Clin. Exp. Pathol. 2015, 8, 10294–10304. [Google Scholar] Lau, P.; Bossers, K.; Janky, R.; Salta, E.; Frigerio, C.S.; Barbash, S.; Rothman, R.; Sierksma, A.S.R.; Thathiah, A.; Greenberg, D.; et al. Alteration of the MicroRNA Network during the Progression of Alzheimer’s Disease. EMBO Mol. Med. 2013, 5, 1613–1634. [Google Scholar] [CrossRef] Kapali, J.; Kabat, B.E.; Schmidt, K.L.; Stallings, C.E.; Tippy, M.; Jung, D.O.; Edwards, B.S.; Nantie, L.B.; Raeztman, L.T.; Navratil, A.M.; et al. Foxo1 Is Required for Normal Somatotrope Differentiation. Endocrinology 2016, 157, 4351–4363. [Google Scholar] [CrossRef] [PubMed] Garrel, G.; Denoyelle, C.; L’Hôte, D.; Picard, J.Y.; Teixeira, J.; Kaiser, U.B.; Laverrière, J.N.; Cohen-Tannoudji, J. GnRH Transactivates Human AMH Receptor Gene via Egr1 and FOXO1 in Gonadotrope Cells. Neuroendocrinology 2019, 108, 65–83. [Google Scholar] [CrossRef] [PubMed] Skarra, D.V.; Arriola, D.J.; Benson, C.A.; Thackray, V.G. Forkhead Box O1 Is a Repressor of Basal and GnRH-Induced Fshb Transcription in Gonadotropes. Mol. Endocrinol. 2013, 27, 1825–1839. [Google Scholar] [CrossRef] [PubMed] Xiao, Z.; Wang, Z.; Hu, B.; Mao, Z.; Zhu, D.; Feng, Y.; Zhu, Y. MiR-1299 Promotes the Synthesis and Secretion of Prolactin by Inhibiting FOXO1 Expression in Drug-Resistant Prolactinomas. Biochem. Biophys. Res. Commun. 2019, 520, 79–85. [Google Scholar] [CrossRef] Benite-Ribeiro, S.A.; de Lima Rodrigues, V.A.; Machado, M.R.F. Food Intake in Early Life and Epigenetic Modifications of Pro-Opiomelanocortin Expression in Arcuate Nucleus. Mol. Biol. Rep. 2021, 48, 3773–3784. [Google Scholar] [CrossRef] Knosp, E.; Steiner, E.; Kitz, K.; Matula, C.; Parent, A.D.; Laws, E.R.; Ciric, I. Pituitary Adenomas with Invasion of the Cavernous Sinus Space: A Magnetic Resonance Imaging Classification Compared with Surgical Findings. Neurosurgery 1993, 33, 610–618. [Google Scholar] [CrossRef] Bujko, M.; Kober, P.; Boresowicz, J.; Rusetska, N.; Zeber-Lubecka, N.; Paziewska, A.; Pekul, M.; Zielinski, G.; Styk, A.; Kunicki, J.; et al. Differential MicroRNA Expression in USP8-Mutated and Wild-Type Corticotroph Pituitary Tumors Reflect the Difference in Protein Ubiquitination Processes. J. Clin. Med. 2021, 10, 375. [Google Scholar] [CrossRef] Mi, H.; Ebert, D.; Muruganujan, A.; Mills, C.; Albou, L.P.; Mushayamaha, T.; Thomas, P.D. PANTHER Version 16: A Revised Family Classification, Tree-Based Classification Tool, Enhancer Regions and Extensive API. Nucleic Acids Res. 2021, 49, D394–D403. [Google Scholar] [CrossRef] Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). From https://www.mdpi.com/1422-0067/23/5/2867/htm

DOI: 10.7759/cureus.22044 Cite this article as: Pattipati M, Gudavalli G (February 09, 2022) Association Between Cushing’s Syndrome and Sleep Apnea: Results From the National Inpatient Sample. Cureus 14(2): e22044. doi:10.7759/cureus.22044 Abstract Background Cushing’s syndrome is a metabolic disorder related to excess cortisol production. Patients with Cushing’s syndrome are at risk for the development of other comorbid medical conditions such as hypertension, diabetes, obesity, and obstructive sleep apnea. Obstructive sleep apnea has been well associated with endocrine disorders such as acromegaly and hypothyroidism. However, its causal association with Cushing’s syndrome is still unclear. We utilized a national database to study the prevalence of sleep apnea in Cushing’s syndrome. Hypothesis We hypothesized that patients with Cushing’s syndrome might have an increased prevalence of sleep apnea. Methods Patients aged above 18 years from the NIS database between 2017 and 2018 with a diagnosis of Cushing’s syndrome and sleep apnea were extracted using the 10th revision of the International Classification of Diseases (ICD-10) codes, with code E24 representing Cushing’s syndrome and G47.3 representing sleep apnea. The prevalence of sleep apnea and other comorbid medical conditions were identified using the ICD-10 codes. Logistic regression analysis was performed to examine the association between Cushing’s syndrome and sleep apnea. Results Cushing’s syndrome was prevalent in 0.037% (2,248 of 6,023,852) of all inpatient hospitalizations. Patients with Cushing’s syndrome were slightly younger (mean age: 54 ± 16 versus 58 ± 20) and more likely to be females (76%, 1,715 out of 2,248) and had higher rates of sleep apnea (21.9% versus 8.7%, p < 0.000) and obstructive sleep apnea (OSA) (18.6% versus 7.2%, p < 0.000) when compared to the general population. Cushing’s syndrome is independently associated with sleep apnea, with an unadjusted odds ratio (OR) of 2.94 (p < 0.01) and an adjusted odds ratio (aOR) of 1.79 after adjusting for demographics and other risk factors for sleep apnea and comorbid medical conditions (p < 0.01). Conclusions Cushing’s syndrome is associated with increased prevalence of sleep apnea and independent predictor of sleep apnea. Further prospective studies are recommended to validate the causal association. The high prevalence and coexistence of both these disorders validate screening for sleep apnea as part of routine workup in patients with Cushing’s syndrome and vice versa. 20220209-420-10au3f.pdf

Highlights • There is a highs suspicion of acute pancreatitis complications for patients with Cushing syndrome. • Corticosteroids are a common cause for both Cushing syndrome and acute pancreatitis. • There are many common etiologies between Cushing syndrome and acute pancreatitis. • Cushing syndrome is a risk factor of acute pancreatitis, need further detailed studies. Abstract Introduction Cushing's syndrome (CS) is a rare and severe disease. Acute pancreatitis is the leading cause of hospitalization. The association of the two disease is rare and uncommon. We report the case of a 37-year-old woman admitted in our service for acute pancreatitis and whose Cushing syndrome was diagnosed during hospitalisation. The aim of this work is to try to understand the influence of de Cushing in acute pancreatitis and to establish a causative relationship between the two diseases. Observation It is a 37-year-old woman with a history of corticosteroid intake for six months, stopped three months ago who consulted for epigastralgia and vomiting. The physical exam found epigastric sensitivity with Cushing syndrome symptoms. A CT scan revealed acute edematous-interstitial pancreatitis stage E of Balthazar classification. 24 h free cortisol of 95 μg/24 h and cortisolemia of 3.4 μg/dl. The patient was treated symptomatically and referred after to endocrinology service for further treatment. Conclusion The association with acute pancreatitis and CS is rare and uncommon. Although detailed studies and evidence are lacking, it can therefore be inferred that CS is one of the risk factors for the onset of acute pancreatitis. The medical treatment and management of acute pancreatitis in those patients do not differ from other pancreatitis of any etiologies. Read the article here.

A young healthcare worker who contracted COVID-19 shortly after being diagnosed with Cushing’s disease was detailed in a case report from Japan. While the woman was successfully treated for both conditions, Cushing’s may worsen a COVID-19 infection. Prompt treatment and multidisciplinary care is required for Cushing’s patients who get COVID-19, its researchers said. The report, “Successful management of a patient with active Cushing’s disease complicated with coronavirus disease 2019 (COVID-19) pneumonia,” was published in Endocrine Journal. Cushing’s disease is caused by a tumor on the pituitary gland, which results in abnormally high levels of the stress hormone cortisol (hypercortisolism). Since COVID-19 is still a fairly new disease, and Cushing’s is rare, there is scant data on how COVID-19 tends to affect Cushing’s patients. In the report, researchers described the case of a 27-year-old Japanese female healthcare worker with active Cushing’s disease who contracted COVID-19. The patient had a six-year-long history of amenorrhea (missed periods) and dyslipidemia (abnormal fat levels in the body). She had also experienced weight gain, a rounding face, and acne. After transferring to a new workplace, the woman visited a new gynecologist, who checked her hormonal status. Abnormal findings prompted a visit to the endocrinology department. Clinical examination revealed features indicative of Cushing’s syndrome, such as a round face with acne, central obesity, and buffalo hump. Laboratory testing confirmed hypercortisolism, and MRI revealed a tumor in the patient’s pituitary gland. She was scheduled for surgery to remove the tumor, and treated with metyrapone, a medication that can decrease cortisol production in the body. Shortly thereafter, she had close contact with a patient she was helping to care for, who was infected with COVID-19 but not yet diagnosed. A few days later, the woman experienced a fever, nausea, and headache. These persisted for a few days, and then she started having difficulty breathing. Imaging of her lungs revealed a fluid buildup (pneumonia), and a test for SARS-CoV-2 — the virus that causes COVID-19 — came back positive. A week after symptoms developed, the patient required supplemental oxygen. Her condition worsened 10 days later, and laboratory tests were indicative of increased inflammation. To control the patient’s Cushing’s disease, she was treated with increasing doses of metyrapone and similar medications to decrease cortisol production; she was also administered cortisol — this “block and replace” approach aims to maintain cortisol levels within the normal range. The patient experienced metyrapone side effects that included stomach upset, nausea, dizziness, swelling, increased acne, and hypokalemia (low potassium levels). She was given antiviral therapies (e.g., favipiravir) to help manage the COVID-19. Additional medications to prevent opportunistic fungal infections were also administered. From the next day onward, her symptoms eased, and the woman was eventually discharged from the hospital. A month after being discharged, she tested negative for SARS-CoV-2. Surgery for the pituitary tumor was then again possible. Appropriate safeguards were put in place to protect the medical team caring for her from infection, during and after the surgery. The patient didn’t have any noteworthy complications from the surgery, and her cortisol levels soon dropped to within normal limits. She was considered to be in remission. Although broad conclusions cannot be reliably drawn from a single case, the researchers suggested that the patient’s underlying Cushing’s disease may have made her more susceptible to severe pneumonia due to COVID-19. “Since hypercortisolism due to active Cushing’s disease may enhance the severity of COVID-19 infection, it is necessary to provide appropriate, multidisciplinary and prompt treatment,” the researchers wrote. From https://cushingsdiseasenews.com/2021/01/15/covid-19-may-be-severe-cushings-patients-case-report-suggests/?cn-reloaded=1

Braun LT, Fazel J, Zopp S Journal of Bone and Mineral Research | May 22, 2020 This study was attempted to assess bone mineral density and fracture rates in 89 patients with confirmed Cushing's syndrome at the time of diagnosis and 2 years after successful tumor resection. Researchers ascertained five bone turnover markers at the time of diagnosis, 1 and 2 years postoperatively. Via chemiluminescent immunoassays, they assessed bone turnover markers osteocalcin, intact procollagen‐IN‐propeptide, alkaline bone phosphatase, CrossLaps, and TrAcP 5b in plasma or serum. For comparison, they studied 71 gender‐, age‐, and BMI‐matched patients in whom Cushing's syndrome had been excluded. The outcomes of this research exhibit that the phase immediately after surgical remission from endogenous CS is defined by a high rate of bone turnover resulting in a striking net increase in bone mineral density in the majority of patients. Read the full article on Journal of Bone and Mineral Research.

With the novel COVID-19 virus continuing to spread, it is crucial to adhere to the advice from experts and the Centers for Disease Control and Prevention (CDC) to help reduce risk of infection for individuals and the population at large. This is particularly important for people with adrenal insufficiency and people with uncontrolled Cushing’s Syndrome. Studies have reported that individuals with adrenal insufficiency have an increased rate of respiratory infection-related deaths, possibly due to impaired immune function. As such, people with adrenal insufficiency should observe the following recommendations: Maintain social distancing to reduce the risk of contracting COVID-19 Continue taking medications as prescribed Ensure appropriate supplies for oral and injectable steroids at home, ideally a 90-day preparation In the case of hydrocortisone shortages, ask your pharmacist and physician about replacement with different strengths of hydrocortisone tablets that might be available. Hydrocortisone (or brand name Cortef) tablets have 5 mg, 10 mg or 20 mg strength In cases of acute illness, increase the hydrocortisone dose per instructions and call the physician’s office for more details Follow sick day rules for increasing oral glucocorticoids or injectables per your physician’s recommendations In general, patients should double their usual glucocorticoid dose in times of acute illness In case of inability to take oral glucocorticoids, contact your physician for alternative medicines and regimens If experiencing fever, cough, shortness of breath or other symptoms, call both the COVID-19 hotline (check your state government website for contact information) and your primary care physician or endocrinologist Monitor symptoms and contact your physician immediately following signs of illness Acquire a medical alert bracelet/necklace in case of an emergency Individuals with uncontrolled Cushing’s Syndrome of any origin are at higher risk of infection in general. Although information on people with Cushing’s Syndrome and COVID-19 is scarce, given the rarity of the condition, those with Cushing’s Syndrome should strictly adhere to CDC recommendations: Maintain social distancing to reduce the risk of contracting COVID-19 If experiencing fever, cough, shortness of breath or other symptoms, call both the COVID-19 hotline (check your state government website for contact information) and your primary care physician or endocrinologist In addition, people with either condition should continue to follow the general guidelines at these times: Stay home as much as possible to reduce your risk of being exposed When you do go out in public, avoid crowds and limit close contact with others Avoid non-essential travel Wash your hands with soap and water regularly, for at least 20 seconds, especially before eating or drinking and after using the restroom and blowing your nose, coughing or sneezing If soap and water are not readily available, use an alcohol-based sanitizer with at least 60% alcohol Cover your nose and mouth when coughing or sneezing with a tissue or a flexed elbow, then throw the tissue in the trash Avoid touching your eyes, mouth or nose when possible From https://www.aace.com/recent-news-and-updates/aace-position-statement-coronavirus-covid-19-and-people-adrenal

On Dec 12th, I am speaking at a sold-out event and telling half of a funny story, then posting it on YouTube, To hear the rest of the story people have to go to my website which is all about Cushing's disease. Every day I see people who I am certain have Cushing's but don't know it. I want to reach these people and the general public. What title can I use for my video? I need your help with this. The story is much like Abbott and Costello's Who's on second, what's on third routine. But there has to be a connection to cushing's. So far, I have: Is it obesity or Cushing's disease? When I get the title and post the video, I need the support of everyone here to view it and go to my website. If you could share and get family and friends to do the same that would be greatly appreciated. Wouldn't it be great if the video went viral and so many people would learn about Cushing's? We can make this happen if I get your support. Thanks everyone. Keep working on a better tite for me. Can't wait to see your suggestions. Thanks again. jan