Jump to content

Search the Community

Showing results for tags 'pituitary'.

  • Search By Tags

    Type tags separated by commas.
  • Search By Author

Content Type


Forums

  • Welcome!
    • Introduce Yourself
    • Guest Questions
    • Cushing's Basics
    • News Items and Research
    • Announcements
    • Questions about how these boards work?
  • Get Active!
    • Meetings, events and information
    • Fundraising Ideas
    • Cushing's Awareness Day, April 8
    • Spread the Word
    • Marathons
    • Cushing's Clothes Closet
    • Cushing's Library
    • Cushing's Store
  • Cushing's
    • Resources
    • Types of Cushing's
    • Symptoms
    • Tests
    • Treatments
  • Miscellaneous
    • Other Diseases
    • Good News / Attitude of Gratitude
    • Inspirational / Motivational
    • Quotes and Affirmations
    • Lighten Up!
    • Word Games
    • Miscellaneous Chit Chat
    • Current Events
    • Cushie Commerce
    • Internet Classes
    • Recipes

Blogs

  • MaryO'Blog
  • Christy Smith's Blog
  • rooon55's Blog
  • LLMart's Blog
  • regina from florida's Blog
  • terri's Blog
  • Canasa's Blog
  • Tberry's Blog
  • LisaMK's Blog
  • diane177432's Blog
  • Jen1978's Blog
  • GreenGal's Blog
  • Yada Yada Yada
  • Jinxie's Blog
  • SherryC's Blog
  • stjfs' Blog
  • kalimae7371's Blog
  • Kristy's Blog
  • kathieb1's Blog
  • Yavanna's Blog
  • Johnni's Blog
  • AutumnOMA's Blog
  • Will Power
  • dropsofjupiter's Blog
  • Lorrie's Blog
  • DebMV's Blog
  • FarWind's Blog
  • sallyt's Blog
  • dseefeldt's Blog
  • ladylena's Blog
  • steffie's Blog
  • Lori L's Blog
  • mysticalsusan1's Blog
  • cathy442's Blog
  • Kathy711's Blog
  • Shannonsmom's Blog
  • jack's Blog
  • Kandy66's Blog
  • mars72's Blog
  • singlesweetness33's Blog
  • michelletm's Blog
  • JC_Adair's Blog
  • Lisa-A's Blog
  • Jen3's Blog
  • tammi's Blog
  • Ramblin' Rose (Maggie's)
  • monicaroni77's Blog
  • monicaroni's Blog
  • Saz's Blog
  • alison
  • Thankful for the Journey
  • Judy from Pgh's Blog
  • Addiegirl's Blog
  • candlelite2000's Blog
  • Courtney likes to talk......
  • Tanya's Blog
  • smoketooash's Blog
  • meyerfamily8's Blog
  • Sheila1366's Blog
  • A Guide to Blogging...
  • Karen's Blog
  • barbj222222's Blog
  • Amdy's Blog
  • Jesh's Blog
  • pumpkin's Blog
  • Jazlady's Blog
  • Cristalrose's Blog
  • kikicee's Blog
  • bordergirl's Blog
  • Shelby's Blog
  • terry.t's Blog
  • CanadianGuy's Blog
  • Mar's Cushie Couch
  • leanne's Blog
  • honeybee30's Blog
  • cat lady's Blog
  • Denarea's Blog
  • Caroline's Blog
  • NatalieC's Blog
  • Ahnjhnsn's Blog
  • A journey around my brain!
  • wisconsin's Blog
  • sonda's Blog
  • Siobhan2007's Blog
  • mariahjo's Blog
  • garcia9's Blog
  • Jessie's Blog
  • Elise T.'s Blog
  • glandular-mass' Blog
  • Rachel Bridgewater's Blog
  • judycolby's Blog
  • CathyM's Blog
  • MelissaTX's Blog
  • nessie21's Blog
  • crzycarin's Blog
  • Drenfro's Blog
  • CathyMc's Blog
  • joanna27's Blog
  • Just my thoughts!
  • copacabana's Blog
  • msmith3033's Blog
  • EyeRishGrl's Blog
  • SaintPaul's Blog
  • joyce's Blog
  • Tara Lou's Blog
  • penybobeny's Blog
  • From Where I Sit
  • Questions..
  • jennsarad's Blog
  • looking4answers2's Blog
  • julie's blog
  • cushiemom's Blog
  • greydragon's Blog
  • AmandaL's Blog
  • KWDesigns: My Cushings Journey
  • cushieleigh's Blog
  • chelser245's Blog
  • melissa1375's Blog
  • MissClaudie's Blog
  • missclaudie92's Blog
  • EEYORETJBD's Blog
  • Courtney's Blog
  • Dawn's Blog
  • Lindsay's Blog
  • rosa's Blog
  • Marva's Blog
  • kimmy's Blog
  • Cheryl's Blog
  • MissingMe's Blog
  • FerolV's Blog
  • Audrey's (phil1088) Blog
  • sugarbakerqueen's Blog
  • KathyBair's Blog
  • Jenn's Blog
  • LisaE's Blog
  • qpdoll's Blog
  • blogs_blog_140
  • beach's Blog
  • Reillmommy is Looking for Answers...
  • natashac's Blog
  • Lisa72's Blog
  • medcats10's Blog
  • KaitlynElissa's Blog
  • shygirlxoxo's Blog
  • kerrim's Blog
  • Nicki's Blog
  • MOPPSEY's Blog
  • Betty's Blog
  • And the beat goes on...
  • Lynn's Blog
  • marionstar's Blog
  • floweroscotland's Blog
  • SleepyTimeTea's Blog
  • Shelly3's Blog
  • fatnsassy's Blog
  • gaga's Blog
  • Jewels' Blog
  • SusieQ's Blog
  • kayc6751's Blog
  • moonlight's Blog
  • Sick of Being Sick
  • Peggy's Blog
  • kouta5m's Blog
  • TerryC's Blog
  • snowii's Blog
  • azZ9's Blog
  • MaMaT333's Blog
  • missaf's Blog
  • libertybell's Blog
  • LyssaFace's Blog
  • suzypar2002's Blog
  • Mutley's Blog
  • superc's Blog
  • lisajo42's Blog
  • alaustin's Blog
  • Tina1962's Blog
  • Ill never complain a single word about anything.. If I get rid of Cushings disease.
  • puddingtoast's Blog
  • AmberC's Blog
  • annacox
  • justwaiting's Blog
  • RachaelB's Blog
  • MelanieW's Blog
  • My Blog
  • FLHeather's Blog
  • HollieK's Blog
  • Bonny777's Blog
  • KatieO's Blog
  • LilDickens' Mini World
  • MelissaG's Blog
  • KelseyMichelle's Blog
  • Synergy's Blog
  • Carolyn1435's Blog
  • Disease is ugly! Do I have to be?
  • A journey of a thousand miles begins with a single wobble
  • MichelleK's Blog
  • lenalee's Blog
  • DebGal's Blog
  • Needed Answers
  • Dannetts Blog
  • Marisa's Blog
  • Is this cushings?
  • alicia26's Blog
  • happymish's Blog
  • mileymo's Blog
  • It's a Cushie Life!
  • The Weary Zebra
  • mthrgonenuts' Blog
  • LoriW's Blog
  • WendyG's Blog
  • khmood's Blog
  • Finding Answers and Pissing Everyone Off Along the Way
  • elainewwjd's Blog
  • brie's Blog
  • dturner242's Blog
  • dturner242's Blog
  • dturner242's Blog
  • Stop the Violins
  • FerolV's Internal Blog
  • beelzebubble's Blog
  • RingetteLUVR
  • Eaglemtnlake's Blog
  • mck25's Blog
  • vicki11's Blog
  • vicki11's Blog
  • ChrissyL's Blog
  • tpatterson757's Blog
  • Falling2Grace's Blog
  • meeks089's Blog
  • JustCurious' Blog
  • Squeak's Blog
  • Kill Bill
  • So It Begins ! Cushings / Pituitary Microadenoma
  • Crystal34's Blog
  • Janice Barrett

Categories

  • Helpful Articles
    • Links
    • Research and News
    • Useful Information
  • Pages
  • Miscellaneous
    • Databases
    • Templates
    • Media

Find results in...

Find results that contain...


Date Created

  • Start

    End


Last Updated

  • Start

    End


Filter by number of...

Joined

  • Start

    End


Group


AIM


MSN


Website URL


ICQ


Yahoo


Jabber


Skype


Location


Interests

  1. Abstract Objective To evaluate whether age-related differences exist in clinical characteristics, diagnostic approach and management strategies in patients with Cushing’s syndrome included in the European Registry on Cushing’s Syndrome (ERCUSYN). Design Cohort study. Methods We analyzed 1791 patients with CS, of whom 1234 (69%) had pituitary-dependent CS (PIT-CS), 450 (25%) adrenal-dependent CS (ADR-CS) and 107 (6%) had an ectopic source (ECT-CS). According to the WHO criteria, 1616 patients (90.2%) were classified as younger (<65 years) and 175 (9.8%) as older (>65 years). Results Older patients were more frequently males and had a lower BMI and waist circumference as compared with the younger. Older patients also had a lower prevalence of skin alterations, depression, hair loss, hirsutism and reduced libido, but a higher prevalence of muscle weakness, diabetes, hypertension, cardiovascular disease, venous thromboembolism and bone fractures than younger patients, regardless of sex (p<0.01 for all comparisons). Measurement of UFC supported the diagnosis of CS less frequently in older patients as compared with the younger (p<0.05). An extra-sellar macroadenoma (macrocorticotropinoma with extrasellar extension) was more common in older PIT-CS patients than in the younger (p<0.01). Older PIT-CS patients more frequently received cortisol-lowering medications and radiotherapy as a first-line treatment, whereas surgery was the preferred approach in the younger (p<0.01 for all comparisons). When transsphenoidal surgery was performed, the remission rate was lower in the elderly as compared with their younger counterpart (p<0.05). Conclusions Older CS patients lack several typical symptoms of hypercortisolism, present with more comorbidities regardless of sex, and are more often conservatively treated. From https://academic.oup.com/ejendo/advance-article-abstract/doi/10.1093/ejendo/lvad008/7030701?redirectedFrom=fulltext&login=false
  2. The following is the summary of “Increased Risk of Ocular Hypertension in Patients With Cushing’s Disease” published in the December 2022 issue of Glaucoma by Ma, et al. Ocular hypertension was more common in people with Cushing’s illness. The usage of steroids in the body is a major contributor to high intraocular pressure (IOP). Topical or systemic glucocorticoid use may increase the prevalence of ocular hypertension in the general population from 30–40%. The prevalence of ocular hypertension in endogenous hypercortisolemia and the ophthalmological consequences following endocrine remission after surgical resection are unknown. During the period of January 2019 through July 2019, all patients with Cushing’s disease (CD) who were hospitalized at a tertiary pituitary facility for surgical intervention had their intraocular pressure (IOP), vision field, and peripapillary retinal nerve fiber layer thickness recorded. Nonfunctioning pituitary adenoma (NFPA) patients and acromegaly patients from the same time period were used as comparison groups. Researchers showed postoperative changes in IOP, estimated the odds ratio (OR), and identified risk variables for the development of ocular hypertension. About 52 patients with CD were included in the study (mean age 38.4±12.4 years). Patients with CD had an IOP that was 19.4±5.4 mm Hg in the left eye and 20.0±7.1 mm Hg in the right eye, which was significantly higher than that of patients with acromegaly (17.5±2.3 mm Hg in the left eye and 18.6±7.0 mm Hg in the right eye, P=0.033) and NFPA (17.8±2.6 mm Hg in the left eye and 17.4±2.4 mm Hg in the right eye, Ocular hypertension was diagnosed in 21 eyes (20.2%) of CD patients, but only 4 eyes (4.7%) of acromegaly patients and 4 eyes (4.5%) of NFPA patients. Patients with CD had an odds ratio (OR) of 5.1 [95% CI, 1.3-25.1, P=0.029] and 6.6 [95% CI, 1.8-30.3, P=0.007] for developing ocular hypertension compared with the 2 control groups. Higher levels of urine-free cortisol were associated with an increased risk of ocular hypertension in CD patients (OR=19.4, 95% CI, 1.7-72.6). Patients with CD saw a decrease in IOP at 1 month following surgery, and this improvement was maintained for another 2 months. Researchers conclude that endogenous hypercortisolemia should be included as part of the glaucoma assessment due to the increased risk of ocular hypertension in CD. Ophthalmologists and neuroendocrinologists should use their judgment in light of this finding. Source: journals.lww.com/glaucomajournal/Fulltext/2022/12000/Increased_Risk_of_Ocular_Hypertension_in_Patients.3.aspx
  3. Abstract Purpose: Transsphenoidal surgery is the first-line treatment for Cushing’s disease (CD), even with negative preoperative magnetic resonance imaging (MRI) results. Some patients with persistent or recurring hypercortisolism have negative MRI findings after the initial surgery. We aimed to analyze the efficacy of repeat surgery in two groups of patients and determine if there is an association between positive MRI findings and early remission. Patients and Methods: Clinical, imaging, and biochemical information of 42 patients who underwent repeat surgery by a single neurosurgeon between 2002 and 2021 was retrospectively analyzed. We compared the endocrinological, histopathological, and surgical outcomes before and after repeat surgery among 14 CD patients with negative MRI findings and 28 patients with positive MRI findings. Results: Immediate remission was achieved in 29 patients (69.0%) who underwent repeat surgery. Among all patients, 28 (66.7%) had MRI findings consistent with solid lesions. There was no significant difference in remission rates between the recurrence and persistence groups (77.8% vs. 57.1%, odds ratio = 2.625, 95% confidence interval = 0.651 to 10.586). Patients in remission after repeat surgery were not associated with positive MRI findings (odds ratio = 3.667, 95% confidence interval = 0.920 to 14.622). Conclusions: In terms of recurrence, repeat surgery in patients with either positive or negative MRI findings showed reasonable remission rates. For persistent disease with positive MRI findings, repeat surgery is still an option; however, more solid evidence is needed to determine if negative MRI findings are predictors for failed reoperations for persistent hypercortisolism. Keywords: Cushing’s disease; MRI; persistence; recurrence; repeat surgery 1. Introduction Transsphenoidal pituitary surgery is the primary treatment choice for patients with Cushing’s Disease (CD), which has a reported remission rate of 70% to 90% [1,2]. However, hypercortisolism persists in some of these surgical patients and recurs in 3–29% of patients, even in those who have benefited from remission for more than a decade [3,4]. In cases in which the primary surgery failed, serval treatments are considered, including reoperation, medication, conventional radiotherapy, radiosurgery, and bilateral adrenalectomy [4]. With remission rates as high as 87% [5], reoperation is a feasible option worth considering. Although some studies have concentrated on the risk factors and long-term outcomes of repeated transsphenoidal surgery [6,7], the necessity of reoperation in patients with varied clinical, imaging, and pathological characteristics has not been adequately discussed. Reoperation is considered when lesions remain visible on magnetic resonance imaging (MRI), given that tumor removal will likely lead to remission, even if it is located in the cavernous sinus [8]. Nevertheless, the incidence of positive MRI findings is typically low in CD patients with either recurrent or persistent disease [5,9,10,11]. Furthermore, MRI has limitations in revealing the accurate structures of the operated area due to distorted anatomy related to the formation of granulation tissue and inflammatory changes after the initial surgery [12]. Unlike the considerable remission rate achieved after the first operation despite negative MRI findings [1], the decision to perform a second operation without visible lesions detected on MRI is challenging for neurosurgeons. These uncertainties emphasize the importance of discussing the risk factors and the necessity of repeat surgery, especially for patients with negative radiological results. Our retrospective study aimed to ascertain the treatment preference for reoperation in patients with persistent and recurrent CD and evaluate the significance of MRI findings for selecting patients that are likely to benefit from reoperation. Furthermore, we aimed to provide a reference for surgeons in making decisions on repeat surgical intervention for patients who are most likely to benefit, thereby improving the remission rates associated with reoperation. 2. Patients and Methods We retrospectively identified patients with CD treated with repeated transsphenoidal surgery between 2002 and 2021 at our institution. Patients with three or more pituitary surgeries were excluded from the present study. The preoperative and postoperative evaluations of the first surgeries are shown in Table 1. All patients fulfilled the following inclusion criteria: persistent hypercortisolism after initial surgery or recurrence after remission with a period of normocortisolism or adrenal insufficiency. Table 1. Preoperative characteristics of the initial surgery. This study included 42 patients aged 44.4 ± 14.6 years at the time of the repeat operation (Table S1). The median interval between the two operations was 43 months (interquartile range [IQR] = 18–90). The median follow-up duration after the second operation was 15.5 months (IQR = 4–59). 2.1. Diagnosis The diagnostic criteria for recurrence in the present study included new onset or recurrence of symptoms, clinical features, serum cortisol level, 24 h urinary-free cortisol (UFC) level, and biochemical tests (low-dose dexamethasone suppression test and high-dose dexamethasone suppression test (HDDST)), which are frequently used to define CD remission, recurrence, and persistence. An algorithm that is currently used in biochemical assessment and management of recurrent and persistent disease is shown in Figure 1. All tests were performed in a College of American Pathologists-accredited laboratory (No. 7217913). Serum cortisol and UFC were examined using an Access Immunoassay System (Beckman Coulter Inc., Fullerton, CA, USA). The normal ranges were 6.7–22.6 µg/dL and 21–111 µg/24 h, respectively. Plasma adrenocorticotropic hormone (ACTH) levels were measured using an ELSA-ACTH immunoradiometric method (Cisbio Bioassays, Codolet, France). The normal range was 12–78 pg/mL. A serum cortisol value of less than 5 μg/dL was considered to indicate remission. Patients who were not considered to be in remission were discharged and routinely evaluated 6 months after surgery for possible delayed remission. Patients were administered oral cortisone and gradually withdrawn to a physiologic replacement dose after 1 month. The yearly follow-up visit included physical examinations and serum cortisol, UFC, and plasma ACTH assessments. MRI was not performed routinely after surgery unless persistent or recurrent hypercortisolism was confirmed biochemically, as postoperative imaging may not be reliably interpreted for hormone-active pituitary adenoma. Figure 1. Algorithm of the biochemical assessment and treatment of persistent and recurrent Cushing’s disease. Contrast-enhanced pituitary MRI at our center was conducted to facilitate diagnosis and surgical planning using a superconducting magnet 1.5/3.0 Tesla scanner (SIGNA; GE Healthcare, Chicago, IL, USA). Before gadolinium injection (0.01 mmol/kg gadopentetate dimeglumine; Magnevist, Berlex Laboratories, Inc., Montville, NJ, USA), T1-weighted spin echo and T2-weighted turbo spin echo images were obtained in the coronal and sagittal planes. Beginning simultaneously with gadolinium injection, coronal and sagittal T1-weighted spin echo images were obtained 2 min after the injection. Imaging studies were independently reviewed by a neuroradiologist, endocrinologist, and the patient’s neurosurgeon. Pituitary imaging prior to the first surgery performed outside of our center was acquired and re-interpreted by the same team. Full agreement was reached on the positive nature of the MRI findings. Otherwise, when MRI findings appeared normal or interpretation was ambiguous, the MRI findings were considered negative. Meanwhile, bilateral inferior petrosal sinus sampling (BIPSS) with or without vasopressin (available after 2015) stimulation was performed in nine patients who experienced recurrence but lacked initially positive ACTH staining on the first histological examination to reconfirm whether the Cushing’s syndrome diagnosis was pituitary-dependent. Two patients were evaluated by BIPSS, although the initial pathology was positive. Regarding persistent disease, among eight patients without positive ACTH staining in their first pathological assessment, five were confirmed by positive BIPSS results and five were confirmed by visible radiological lesions. Only one patient with negative ACTH-staining adenoma underwent repeat surgery with either negative BIPSS results or negative imaging findings. 2.2. Surgical Procedure The same surgeon performed surgery on all patients via the mononostril transsphenoidal approach under a microscope or endoscope (available from December 2015). The initial location prior to the first operation did not guide the resection during repeat surgery. For each patient with positive MRI results, the imaging-identified areas for adenoma were biopsied as frozen sections for the initial pathological evaluation. Subsequent resection with a rim of pituitary tissue around the tumor cavity was conducted to confirm neoplasm-free margins. No further exploration was performed before frozen pathology confirmation was available unless the BIPSS result showed an increased ACTH level on the other side. For invisible tumors on MRI, the dura mater was opened widely to facilitate exploration of the whole gland, starting from the initial location on MRI before the first surgery or the side with the higher ACTH level in the BIPSS, if available. If no obvious tumor was identified on this side by the neurosurgeon intraoperatively, half of the gland was resected using the guidance of BIPSS lateralization. If a tumor was frozen pathologically and identified after half of the gland was removed, the residual gland remained unresected and was only gently explored and sampled in the most suspected area. In some circumstances in which the frozen section was negative, it was subjected to a subtotal adenohypophysectomy of the intermediate lobe and neurohypophysis. If invasive adenoma characteristics were also identified, the involved dura and medial wall of the cavernous sinus were resected or coagulated. A sample was collected for postoperative pathological confirmation, if available. 2.3. Outcome Patients were defined as being in remission with an immediate postoperative serum cortisol nadir <5 μg/dL or 24 h UFC at a normal level [13]. Persistent hypercortisolism was defined as an increased postoperative UFC level, while recurrent hypercortisolism was defined as a reappearance of hypercortisolism after a period of normocortisolism or adrenal insufficiency. 2.4. Statistical Analysis Descriptive statistics are presented as means ± standard deviations when normally distributed or medians and ranges when not normally distributed to describe patient outcome measures and incidence of remission among the study population. Statistical significance was set at a p value < 0.05. Fisher’s exact test was used to compare proportions of categorical measures between groups. All analyses were conducted using Instat (GraphPad Software, San Diego, CA, USA). 3. Results 3.1. Patient Characteristics The basic information and perioperative evaluations of the two operations are shown in Table 1 and Table S1. Among all 27 recurrent cases, the preoperative MRI before the first operation showed a definite pituitary adenoma. The other 12 patients with persistent hypercortisolism had positive MRI findings before the first surgery. The remaining three patients with negative radiographic findings were diagnosed with CD and underwent the first transsphenoidal surgery (TSS) based on their endocrinological results. For patients with confirmed persistent or recurrent CD, the imaging findings prior to the second operation of 14 individuals were negative (no solid evidence of tumors), and 28 clearly had positive results for the presence of a solid lesion. All patients who underwent a second surgery for recurrent or persistent hypercortisolism after the initial surgery were endocrinologically re-evaluated before the repeat surgery. There were 38 cases with positive HDDST results among 42 patients. BIPSS was performed in 18 patients with only one that did not reach the criteria of pituitary origin. 3.2. Outcome In our study, 29 of 42 patients (69.0%, 22 recurrent and 7 persistent cases of CD) were in remission after the repeat operation without additional therapy during follow-up (Table S1). At follow-up, compared with patients with persistent disease, the recurrence group had a higher remission rate, although the difference was not significant (77.8% [21/27] vs. 57.1% [8/15]; p > 0.05; odds ratio = 2.625, 95% confidence interval = 0.651 to 10.586). Negative preoperative MRI findings were not associated with lower odds of immediate remission after repeat surgery (p > 0.05; odds ratio = 3.667, 95% confidence interval = 0.920 to 14.622; Table 2). Table 2. The remission rate of the recurrent and persistent hypercortisolism patients with or without positive MRI findings. 3.3. Association between Outcomes and MRI Findings The remission rates of the persistent and recurrent disease groups with positive and negative MRI findings prior to the second procedure are shown in Table 2. Twenty-nine patients whose MRI findings revealed the existence of pituitary adenomas achieved successful outcomes after reoperation (Representative case, #19, Figure 2). The other seven patients who experienced recurrent or persistent hypercortisolism without clear imaging evidence of tumor appearance also benefited from reoperation (Representative case, #11, Figure 3). Figure 2. Preoperative and postoperative MR images of the two operations (A–D) demonstrate an in situ relapsed intrasellar mass (yellow arrow). Biochemical results obtained before and after the operations (E) show the tumor-related hormone change. KCZ, ketoconazole; MR, magnetic resonance. Figure 3. MR images (A) demonstrated a pituitary microadenoma on the left side (yellow arrow) before the first operation but not at the subsequent follow-ups (B,C). The biochemical results obtained before the second operation (D) revealed hypercortisolism indicating relapse without obvious MRI confirmation. MR, magnetic resonance; MRI, magnetic resonance imaging. 3.4. Pathology Respectively, 15/27 (55.6%) and 7/15 (46.7%) patients with recurrent and persistent hypercortisolism had ACTH-positive staining in the first pathological findings. Among patients who achieved remission after the second operation, 20 of 29 patients had confirmed adenoma with positive ACTH pathological staining, while 3 patients with adenoma were ACTH-negative. There were five patients that did not achieve remission even though they had positive ACTH-staining adenoma in the second pathological examination. Meanwhile, five patients achieved remission, although no adenomas were found in their pathological specimens. Overall, positive pathology after either the initial or repeated surgery was not a significant predictor for remission after the second surgery. 3.5. Complications Four of forty-two patients experienced major postoperative complications and underwent medical or surgical interventions. Most patients recovered well after the second operation, except in one case with persistent hypercortisolism, where a severe intracranial infection led to death. Another three cases with cerebral spinal fluid leakage related to the second operation were successfully surgically repaired afterwards. Hypopituitarism was a common complication in this subgroup of CD. All of the patients in remission after the second TSS underwent glucocorticoid replacement therapy (hydrocortisone or cortisone), adjusted according to the 24 h UFC. A total of 20 patients (20/29, 68.9%) underwent thyroxine replacement therapy. Three patients (3/29, 10.3%) had permanent diabetes insipidus. In the non-remission group, five patients (5/13, 38.5%) experienced hypothyroidism, and two patients (2/13, 15.4%) had permanent diabetes insipidus. 4. Discussion In the present study, we reported outcomes for 42 patients undergoing repeat TSS for recurrent and persistent disease in which an overall remission rate of 69.0% was achieved. Immediate remission rates after reoperation for recurrence have been reported in the literature up to 87% [13,14], which is similar to those of other second-line therapies such as radiation therapy and medical treatment. The CD recurrence rate after the initial TSS is reportedly 10–25% with a follow-up time of 10 years [15,16,17]. Ram et al. reported that surgeons performed a second TSS immediately after the first TSS when the postoperative serum cortisol level did not meet the standard level of remission. With an interval time of 1 to 6 weeks, 71% of patients with persistent disease achieved immediate remission, and 53% (9/17) achieved long-term remission [13]. Another study showed a remission rate of 70% with reoperation performed within 10 days [18]. A second TSS reportedly leads an additional 8% of patients to long-term CD remission [3]. Recurrence groups had slightly higher remission rates, which are insignificant when compared with persistent groups in the present study. Similar findings are demonstrated in the study by Ram et al. implicating that failure of the initial surgery suggested that the patient was more difficult to treat successfully with surgery than most patients with recurrence [13]. Therefore, the selection criteria for potential patients and reoperation strategies require further discussion. 4.1. Surgical Strategy The surgical strategy for the initial CD surgery varies depending on the major concerns of different pituitary surgeons. Some surgeons intend to preserve more normal gland tissue during surgery while others chase higher remission rates. Selective adenectomy is a reasonable choice for visible tumors. Several authors adopted a slightly extended resection with a rim or sometimes 2–3 mm of like-normal tissue around the tumor, which could be considered a partial hypophysectomy [19,20]. A hemi-hypophysectomy is more common in cases in which no tumor was identified during the operation, and the MRI or BIPSS results indicated remarkable lateralization of the tumor origin [21]. Wide exploration of the contralateral side should also be conducted in cases in which BIPSS results are inconsistent with the MRI findings, which may help identify tiny tumors. More extensive procedures, including subtotal or sometimes total pituitary gland resection, have been performed to maximize remission rates up to 75.9–81.8% [20,22], which may be a reasonable recommendation when imaging/intraoperative findings are not definitive, considering the negative impacts on reoperated patients with persistent hypercortisolism rather than hypopituitarism. Interestingly, pathological confirmation rates are fairly low in cases with extended resection even though they show high remission rates. There seems to be a current trend of surgeons performing a partial hypophysectomy, as a total hypophysectomy can lead to hypopituitarism [5,22,23], given that it may not obviously increase remission rates and may decrease quality of life [24]. 4.2. MRI Findings Regarding radiological findings, we emphasize that negative MRI findings do not necessarily indicate the inexistence of pituitary adenomas or negative pathological results. A number of cases in the study by Wagenmakers et al. showed that remission achieved after repeated transsphenoidal surgery was not predictable by positive MRI findings before the first or second operation [10]. Preoperative MRI provides a reference for the diagnosis of pituitary adenomas, although it has a limited predictive function for patient prognosis [9], especially for the repeat operation in which the original anatomical structure was more or less destroyed in the initial surgery. A positive MRI finding before the second operation should promote confidence in surgeons. The remission rate after reoperation with positive MRI findings was reportedly as high as 72.7% [10]. According to our study, the two positive-MRI groups with different initial surgical outcomes showed higher remission rates, albeit insignificantly. Positive MRI findings suggest better endocrinological outcomes may be achieved by a second operation in both recurrent and persistent disease groups compared with patients with negative imaging findings. An excellent remission rate (more than 80%) was achieved in the recurrent group with positive MRI findings, thus encouraging a repeat TSS. An acceptable remission rate (over 60%) close to those of alternative treatment options was observed in the recurrent group with negative MRI findings, as well as the persistent group with positive MRI findings. We noted that one patient with persistent CD and negative MRI findings achieved remission after reoperation. Therefore, whether a second surgical treatment is beneficial for these patients should be carefully considered. Regarding the recurrent or persistent cases of CD, patients underwent an initial surgery, and we regarded the MRI findings as a possible method to assist in decision making. A second operation is considered when visible lesions remain on MRI under the assumption that removal of the residual tumor leads to remission of the disease. Meanwhile, some recurrent and persistent patients with negative MRI findings also benefited from reoperation. Furthermore, MRI has its limitations in revealing the accurate structures of the originally operated area. The distortion and cicatrization from the previous operation and material packing in the sellar region lead to confusion [12,25]. Unlike the considerable remission rate achieved after the initial operation despite negative MRI findings, reoperation without certain lesion detection on MRI is associated with dissatisfactory remission rates [1], similar to the results of our study. Nevertheless, Knappe and Lüdecke [9] presented a different opinion regarding the significance of MRI findings and reported that it was not usually helpful for determining therapeutic strategies due to its low incidence of detecting existing microadenomas (missed diagnosis in 38–70% of cases). However, the BIPSS results in these cases in which MRI revealed no definitive information on tumors are therefore critical for surgeons to ascertain the pituitary origin of the disease, although another study suggested that MRI and BIPSS do not help locate recurrent tumors [10]. MRI may not help identify tumors in the cavernous sinus or other parasellar regions. 4.3. Pathology We compared the pathological results and remission situations of recurrent patients and persistent patients and failed to find any relationship between pathological results and remission expectations. These findings are supported by the findings of Ram et al. [13], in which no tumors were found in 11 of 17 patients during the second procedure, and 6 of 11 patients achieved remission. In a series by Locatelli et al. [11], no tumors were found in 8 of 12 patients during the second operation, and 5 had surgical remissions. Even in cases of remission, the positive rate of pathological exams was not as high as expected. There was no significant difference in remission rates between patients grouped by pathological results or one-to-one correspondence between histopathological confirmation and surgical outcomes [11]. To date, little evidence supports the prediction of reoperation outcomes by either of the two pathology results. 4.4. Other Considerations and Factors In patients with recurrent and persistent hypercortisolism after their first operation, it was difficult to identify solid lesions on MRI compared with the initial preoperative scans. Notably, BIPSS may provide more information, especially for patients who did not undergo this test before the first operation. Moreover, it may help avoid unnecessary repeat TSS in patients with persistent hypercortisolism by revealing false positives for pituitary ACTH overproduction. BIPSS results have the potential to not only confirm the pituitary origin of the condition (despite the fact that the first histological examination did not show ACTH-positive staining) but also to guide exploration and decision making for a hemi-hypophysectomy or accessing the cavernous sinus, especially for patients without obvious tumors identified intraoperatively. Careful dissection is highly recommended on the side of the obviously lateralized BIPSS results, which sometimes also indicate cavernous sinus invasion not shown on MRI and the necessity of opening the medical wall to achieve extended exploration. The predictive value of BIPSS lateralization in repeated surgery requires further investigation, although it is not optimal in native patients with CD [26]. According to a study by Lonser et al. [27], over 20% of CD patients had cavernous sinus invasion that was confirmed histologically. The authors advocated for complete resection, including the invaded sella dura and medial cavernous sinus wall by an experienced surgeon’s hands. Notably, endoscopy with magnification and lighting provides a panoramic view to facilitate extended exploration of the sella, including the cavernous sinus, compared with the microscope-based approach. Micko et al. demonstrated that an endoscope allows for a radical inspection of the entire medial wall of the cavernous sinus [28] and increases the lateral angle of visualizations to facilitate differentiation between tumor tissues and other tissues. These advantages over the microscopic transsphenoidal approach are critical for recurrent and unremitted cases; however, further studies with larger sample sizes are needed to verify this conclusion. 4.5. Other Adjunctive Treatments to Repeat Surgery Previous studies have noted that ketoconazole may contribute to enhanced tumor appearance on MRI to facilitate pituitary resection in some circumstances [29]. Castinetti et al. reported that visible lesions may be identified on MRI in one-third of patients who were administered ketoconazole [30]. In the literature, reoperation for persistent cases without visible lesions on MRI is rarely satisfactory [31], although these patients may benefit from radiosurgery using the entire sellar region as the therapeutic target [32]. The hormonal normalization was achieved after radiosurgery in half of the cases, including those with negative MRI findings [33]. In general, the radiosurgery outcomes and the less commonly used radiotherapy are more favorable, particularly in MRI-negative cases with persistent hypercortisolism compared with repeat surgery, with potentially fewer complications and a shorter length of hospital stay [34,35]. Salvage TSS for refractory CD after radiation therapy has rarely been reported [36] owing to the difficulty of disrupting surgical landmarks, the formation of scar tissue, and the effects of preoperative radiotherapy [34]. Bilateral adrenalectomy is generally considered the ultima ratio in patients who fail to respond to other treatment options. However, patients who undergo bilateral adrenalectomy will require lifelong surveillance of the corticotroph tumor’s progression, which may lead to Nelson’s syndrome, via MRI and ACTH measurements. Most experts agree that selective transsphenoidal adenomectomy should be recommended as the first-line therapy in patients with Nelson’s syndrome before extrasellar expansion of the tumor occurs [37]. 4.6. Limitations Similar to previous studies, our sample size was not large enough to conduct powerful statistical analyses. Some patients lost during follow-up limited the evaluation of long-term outcomes in the current study. We observed a trend in the predictable values of positive preoperative MRI findings, which is not enough evidence to support an apparent relationship. A potential weakness of the present study is that the outcome was only focused on the biochemical benefits of remission after surgical intervention, possibly leading to an underestimation of the risks of hypopituitarism and decreased quality of life. Indeed, larger case series are needed to further investigate the potential predictive factors and best surgical strategy. 5. Conclusions Patients with initial surgical treatment may experience hypercortisolism without positive MRI findings in both recurrent and persistent disease. Our findings suggest that for most patients who experience recurrent or persistent CD, reoperation should be an option even with negative MRI findings. However, further comprehensive investigation on recurrent or persistent CD patients is required. Larger groups of surgically treated CD patients with long follow-up periods should be evaluated to improve reoperation outcomes and determine the appropriate selection criteria for repeat surgery, especially for persistent CD patients. Supplementary Materials The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jcm11226848/s1, Table S1. Preoperative and postoperative evaluation of the repeated surgery of 42 patients. Author Contributions B.W. and Y.S. contributed to the study’s conception and design. S.Z. drafted the manuscript. J.R., Z.Z., H.J., Q.S., T.S. and W.W. contributed to data acquisition, analysis, and interpretation. B.W. and Y.S. critically revised the manuscript for important intellectual content. Y.S. and L.B. accept final responsibility for this article. All authors have read and agreed to the published version of the manuscript. Funding This work was supported in part by the National Natural Science Foundation of China (82000751) and the Shanghai Sailing Program (20YF1438900). Institutional Review Board Statement This study involving human participants was conducted in accordance with the 1964 Helsinki declaration and its later amendments or comparable ethical standards and was approved by the Ruijin Hospital Ethics Committee of Shanghai Jiao Tong University School of Medicine (approval number 2020-64). Informed Consent Statement The need for individual consent was waived by the Ethics Committee owing to the retrospective nature of the study. Data Availability Statement All data generated or analyzed during this study are included in this article. Further enquiries may be directed to the corresponding authors. Conflicts of Interest The authors have no relevant financial or non-financial interests to disclose. References Sun, Y.; Sun, Q.; Fan, C.; Shen, J.; Zhao, W.; Guo, Y.; Su, T.; Wang, W.; Ning, G.; Bian, L. Diagnosis and therapy for Cushing’s disease with negative dynamic MRI finding: A single-centre experience. Clin. Endocrinol. 2012, 76, 868–876. [Google Scholar] [CrossRef] Tritos, N.A.; Biller, B.M.K. Current management of Cushing’s disease. J. Intern. Med. 2019, 286, 526–541. [Google Scholar] [CrossRef] [PubMed] Dimopoulou, C.; Schopohl, J.; Rachinger, W.; Buchfelder, M.; Honegger, J.; Reincke, M.; Stalla, G.K. Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: Care reality in the Munich Metropolitan Region. Eur. J. Endocrinol. 2014, 170, 283–292. [Google Scholar] [CrossRef] [PubMed] Rutkowski, M.J.; Flanigan, P.M.; Aghi, M.K. Update on the management of recurrent Cushing’s disease. Neurosurg. Focus 2015, 38, E16. [Google Scholar] [CrossRef] [PubMed] Burke, W.T.; Penn, D.L.; Repetti, C.S.; Iuliano, S.; Laws, E.R. Outcomes After Repeat Transsphenoidal Surgery for Recurrent Cushing Disease: Updated. Neurosurgery 2019, 85, E1030-e6. [Google Scholar] [CrossRef] [PubMed] Alexandraki, K.I.; Kaltsas, G.A.; Isidori, A.M.; Storr, H.L.; Afshar, F.; Sabin, I.; Akker, S.A.; Chew, S.L.; Drake, W.M.; Monson, J.P.; et al. Long-term remission and recurrence rates in Cushing’s disease: Predictive factors in a single-centre study. Eur. J. Endocrinol. 2013, 168, 639–648. [Google Scholar] [CrossRef] Espinosa-de-Los-Monteros, A.L.; Sosa-Eroza, E.; Espinosa, E.; Mendoza, V.; Arreola, R.; Mercado, M. Long-term outcome of the different treatment alternatives for recurrent and persistent cushing disease. Endocr. Pract. 2017, 23, 759–767. [Google Scholar] [CrossRef] [PubMed] Mastorakos, P.; Taylor, D.G.; Chen, C.-J.; Buell, T.; Donahue, J.H.; Jane, J.A. Prediction of cavernous sinus invasion in patients with Cushing’s disease by magnetic resonance imaging. J. Neurosurg. 2018, 130, 1593–1598. [Google Scholar] [CrossRef] Knappe, U.J.; Lüdecke, D.K. Persistent and recurrent hypercortisolism after transsphenoidal surgery for Cushing’s disease. Acta Neurochir. Suppl. 1996, 65, 31–34. [Google Scholar] [CrossRef] Wagenmakers, M.A.; Netea-Maier, R.T.; van Lindert, E.J.; Timmers, H.J.; Grotenhuis, J.A.; Hermus, A.R. Repeated transsphenoidal pituitary surgery (TS) via the endoscopic technique: A good therapeutic option for recurrent or persistent Cushing’s disease (CD). Clin. Endocrinol. 2009, 70, 274–280. [Google Scholar] [CrossRef] Locatelli, M.; Vance, M.L.; Laws, E.R. Clinical review: The strategy of immediate reoperation for transsphenoidal surgery for Cushing’s disease. J. Clin. Endocrinol. Metab. 2005, 90, 5478–5482. [Google Scholar] [CrossRef] [PubMed] Wang, F.; Zhou, T.; Wei, S.; Meng, X.; Zhang, J.; Hou, Y.; Sun, G. Endoscopic endonasal transsphenoidal surgery of 1166 pituitary adenomas. Surg. Endosc. 2015, 29, 1270–1280. [Google Scholar] [CrossRef] Ram, Z.; Nieman, L.K.; Cutler, G.B., Jr.; Chrousos, G.P.; Doppman, J.L.; Oldfield, E.H. Early repeat surgery for persistent Cushing’s disease. J. Neurosurg. 1994, 80, 37–45. [Google Scholar] [CrossRef] [PubMed] Aranda, G.; Enseñat, J.; Mora, M.; Puig-Domingo, M.; Martínez de Osaba, M.J.; Casals, G.; Verger, E.; Ribalta, M.T.; Hanzu, F.A.; Halperin, I. Long-term remission and recurrence rate in a cohort of Cushing’s disease: The need for long-term follow-up. Pituitary 2015, 18, 142–149. [Google Scholar] [CrossRef] [PubMed] Swearingen, B.; Biller, B.M.; Barker, F.G., 2nd; Katznelson, L.; Grinspoon, S.; Klibanski, A.; Zervas, N.T. Long-term mortality after transsphenoidal surgery for Cushing disease. Ann. Intern. Med. 1999, 130, 821–824. [Google Scholar] [CrossRef] Atkinson, A.B.; Kennedy, A.; Wiggam, M.I.; McCance, D.R.; Sheridan, B. Long-term remission rates after pituitary surgery for Cushing’s disease: The need for long-term surveillance. Clin. Endocrinol. 2005, 63, 549–559. [Google Scholar] [CrossRef] Patil, C.G.; Prevedello, D.M.; Lad, S.P.; Vance, M.L.; Thorner, M.O.; Katznelson, L.; Laws, E.R., Jr. Late recurrences of Cushing’s disease after initial successful transsphenoidal surgery. J. Clin. Endocrinol. Metab. 2008, 93, 358–362. [Google Scholar] [CrossRef] Trainer, P.J.; Lawrie, H.S.; Verhelst, J.; Howlett, T.A.; Lowe, D.G.; Grossman, A.B.; Savage, M.O.; Afshar, F.; Besser, G.M. Transsphenoidal resection in Cushing’s disease: Undetectable serum cortisol as the definition of successful treatment. Clin. Endocrinol. 1993, 38, 73–78. [Google Scholar] [CrossRef] Guilhaume, B.; Bertagna, X.; Thomsen, M.; Bricaire, C.; Vila-Porcile, E.; Olivier, L.; Racadot, J.; Derome, P.; Laudat, M.H.; Girard, F. Transsphenoidal pituitary surgery for the treatment of Cushing’s disease: Results in 64 patients and long term follow-up studies. J. Clin. Endocrinol. Metab. 1988, 66, 1056–1064. [Google Scholar] [CrossRef] Hammer, G.D.; Tyrrell, J.B.; Lamborn, K.R.; Applebury, C.B.; Hannegan, E.T.; Bell, S.; Rahl, R.; Lu, A.; Wilson, C.B. Transsphenoidal microsurgery for Cushing’s disease: Initial outcome and long-term results. J. Clin. Endocrinol. Metab. 2004, 89, 6348–6357. [Google Scholar] [CrossRef] Bakiri, F.; Tatai, S.; Aouali, R.; Semrouni, M.; Derome, P.; Chitour, F.; Benmiloud, M. Treatment of Cushing’s disease by transsphenoidal, pituitary microsurgery: Prognosis factors and long-term follow-up. J. Endocrinol. Investig. 1996, 19, 572–580. [Google Scholar] [CrossRef] [PubMed] Carr, S.B.; Kleinschmidt-DeMasters, B.K.; Kerr, J.M.; Kiseljak-Vassiliades, K.; Wierman, M.E.; Lillehei, K.O. Negative surgical exploration in patients with Cushing’s disease: Benefit of two-thirds gland resection on remission rate and a review of the literature. J. Neurosurg. 2018, 129, 1260–1267. [Google Scholar] [CrossRef] [PubMed] Rees, D.A.; Hanna, F.W.; Davies, J.S.; Mills, R.G.; Vafidis, J.; Scanlon, M.F. Long-term follow-up results of transsphenoidal surgery for Cushing’s disease in a single centre using strict criteria for remission. Clin. Endocrinol. 2002, 56, 541–551. [Google Scholar] [CrossRef] [PubMed] Santos, A.; Resmini, E.; Gómez-Ansón, B.; Crespo, I.; Granell, E.; Valassi, E.; Pires, P.; Vives-Gilabert, Y.; Martínez-Momblán, M.A.; de Juan, M.; et al. Cardiovascular risk and white matter lesions after endocrine control of Cushing’s syndrome. Eur. J. Endocrinol 2015, 173, 765–775. [Google Scholar] [CrossRef] Abe, T.; Tanioka, D.; Sugiyama, K.; Kawamo, M.; Murakami, K.; Izumiyama, H. Electromagnetic field system for transsphenoidal surgery on recurrent pituitary lesions—Technical note. Surg. Neurol. 2007, 67, 40–44; discussion 44–45. [Google Scholar] [CrossRef] Deipolyi, A.; Bailin, A.; Hirsch, J.A.; Walker, T.G.; Oklu, R. Bilateral inferior petrosal sinus sampling: Experience in 327 patients. J. Neurointerventional Surg. 2017, 9, 196–199. [Google Scholar] [CrossRef] Lonser, R.R.; Ksendzovsky, A.; Wind, J.J.; Vortmeyer, A.O.; Oldfield, E.H. Prospective evaluation of the characteristics and incidence of adenoma-associated dural invasion in Cushing disease. J. Neurosurg. 2012, 116, 272–279. [Google Scholar] [CrossRef] Micko, A.S.; Wöhrer, A.; Wolfsberger, S.; Knosp, E. Invasion of the cavernous sinus space in pituitary adenomas: Endoscopic verification and its correlation with an MRI-based classification. J. Neurosurg. 2015, 122, 803–811. [Google Scholar] [CrossRef] [PubMed] Lau, D.; Rutledge, C.; Aghi, M.K. Cushing’s disease: Current medical therapies and molecular insights guiding future therapies. Neurosurg. Focus 2015, 38, E11. [Google Scholar] [CrossRef] Castinetti, F.; Morange, I.; Jaquet, P.; Conte-Devolx, B.; Brue, T. Ketoconazole revisited: A preoperative or postoperative treatment in Cushing’s disease. Eur. J. Endocrinol. 2008, 158, 91–99. [Google Scholar] [CrossRef] Valderrábano, P.; Aller, J.; García-Valdecasas, L.; García-Uría, J.; Martín, L.; Palacios, N.; Estrada, J. Results of repeated transsphenoidal surgery in Cushing’s disease. Long-term follow-up. Endocrinol. Nutr. 2014, 61, 176–183. [Google Scholar] [CrossRef] [PubMed] Sheehan, J.M.; Vance, M.L.; Sheehan, J.P.; Ellegala, D.B.; Laws, E.R., Jr. Radiosurgery for Cushing’s disease after failed transsphenoidal surgery. J. Neurosurg. 2000, 93, 738–742. [Google Scholar] [CrossRef] [PubMed] Jagannathan, J.; Sheehan, J.P.; Jane, J.A. Evaluation and management of Cushing syndrome in cases of negative sellar magnetic resonance imaging. Neurosurg. Focus 2007, 23, E3. [Google Scholar] [CrossRef] [PubMed] Benveniste, R.J.; King, W.A.; Walsh, J.; Lee, J.S.; Delman, B.N.; Post, K.D. Repeated transsphenoidal surgery to treat recurrent or residual pituitary adenoma. J. Neurosurg. 2005, 102, 1004–1012. [Google Scholar] [CrossRef] Jahangiri, A.; Wagner, J.; Han, S.W.; Zygourakis, C.C.; Han, S.J.; Tran, M.T.; Miller, L.M.; Tom, M.W.; Kunwar, S.; Blevins, L.S., Jr.; et al. Morbidity of repeat transsphenoidal surgery assessed in more than 1000 operations. J. Neurosurg. 2014, 121, 67–74. [Google Scholar] [CrossRef] McCollough, W.M.; Marcus, R.B., Jr.; Rhoton, A.L., Jr.; Ballinger, W.E.; Million, R.R. Long-term follow-up of radiotherapy for pituitary adenoma: The absence of late recurrence after greater than or equal to 4500 cGy. Int. J. Radiat. Oncol. Biol. Phys. 1991, 21, 607–614. [Google Scholar] [CrossRef] Reincke, M.; Albani, A.; Assie, G.; Bancos, I.; Brue, T.; Buchfelder, M.; Chabre, O.; Ceccato, F.; Daniele, A.; Detomas, M.; et al. Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): Systematic review and expert consensus recommendations. Eur. J. Endocrinol. 2021, 184, P1–P16. [Google Scholar] [CrossRef] Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Share and Cite MDPI and ACS Style Wang, B.; Zheng, S.; Ren, J.; Zhong, Z.; Jiang, H.; Sun, Q.; Su, T.; Wang, W.; Sun, Y.; Bian, L. Reoperation for Recurrent and Persistent Cushing’s Disease without Visible MRI Findings. J. Clin. Med. 2022, 11, 6848. https://doi.org/10.3390/jcm11226848 AMA Style Wang B, Zheng S, Ren J, Zhong Z, Jiang H, Sun Q, Su T, Wang W, Sun Y, Bian L. Reoperation for Recurrent and Persistent Cushing’s Disease without Visible MRI Findings. Journal of Clinical Medicine. 2022; 11(22):6848. https://doi.org/10.3390/jcm11226848 Chicago/Turabian Style Wang, Baofeng, Shuying Zheng, Jie Ren, Zhihong Zhong, Hong Jiang, Qingfang Sun, Tingwei Su, Weiqing Wang, Yuhao Sun, and Liuguan Bian. 2022. "Reoperation for Recurrent and Persistent Cushing’s Disease without Visible MRI Findings" Journal of Clinical Medicine 11, no. 22: 6848. https://doi.org/10.3390/jcm11226848 Find Other Styles Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. See further details here. Article Metrics Citations No citations were found for this article, but you may check on Google Scholar Article Access Statistics Article access statisticsArticle Views20. Nov21. Nov22. Nov23. Nov24. Nov25. Nov26. Nov27. Nov28. Nov29. Nov30. Nov1. Dec2. Dec3. Dec4. Dec5. Dec6. Dec7. Dec8. Dec9. Dec10. Dec0100200300400500 For more information on the journal statistics, click here. Multiple requests from the same IP address are counted as one view. From https://www.mdpi.com/2077-0383/11/22/6848
  4. The study covered in this summary was published on researchsquare.com as a preprint and has not yet been peer reviewed. Key Takeaways The hypothalamic-pituitary-adrenal (HPA) axis recovered in nearly three quarters of patients with Cushing disease (CD) within 2 years after successful trans-sphenoidal surgery (TSS), with a median recovery time of 12 months. Preoperative total triiodothyronine (TT3) level appears to be an independent predictor of central adrenal insufficiency (CAI) in CD patients with biochemical remission post surgery. Why This Matters Transient CAI typically occurs after successful TSS, requiring physiologic hydrocortisone replacement until HPA recovery. Inadequate replacement may result in glucocorticoid withdrawal symptoms, including adrenal crisis, while overreplacement could lead to glucocorticoid side effects. Findings have been inconsistent regarding recovery time in CD patients and factors predicting HPA axis recovery. The new findings could help clinicians predict HPA axis-function recovery time and adjust cortisone replacement treatment in postoperative CD patients. Study Design The retrospective study included 140 patients with biochemical remission following CD surgery at a single institution from 2014–2020. Key Results The HPA axis in 103 patients (73.6%) recovered during 2 years' postsurgical follow-up. In 57 patients (55% of this subgroup), it recovered within 12 months. Patients were considered to have recovered if they achieved central adrenal sufficiency (CAS). These patients were significantly younger and had significantly lower midnight levels of adrenocorticotrophic hormone at baseline than those with persistent CAI. The researchers found no significant differences in gender, disease duration, maximal tumor diameter, or history of surgery between the two groups at the time of their diagnosis with CD. Both TT3 and free triiodothyronine levels were significantly lower in patients with persistent CAI vs CAS. There were no significant differences between the two groups in other laboratory parameters, surgical approach, or extended compared with nonextended resection, but more patients in the persistent CAI group underwent partial hypophysectomy. In a multiple logistic regression analysis, TT3 levels at diagnosis independently and significantly predicted HPA recovery at 2-year follow-up post surgery after adjustment for gender, age, duration at diagnosis, maximum tumor diameter, history of surgery, surgical approach (endoscopic or microscopic transsphenoidal surgery), adenomectomy range, and the minimal serum cortisol level within the first 7 postoperative days. Among the 37 patients with persistent CAI at 2 years, 23 (62%) had multiple pituitary axis dysfunctions, including hypothyroidism (19 patients), hypogonadism (19), and central diabetes insipidus (5). Limitations This retrospective study could not prove the causality of TT3 level for influencing recovery of the HPA axis. However, the number of enrolled patients was relatively large, and follow-up was regular ― factors that make the conclusion credible and representative, the authors said. Disclosures The study received no commercial funding. The authors had no disclosures. This is a summary of a preprint research study, "The Recovery Time of Hypothalamic-Pituitary-Adrenal Axis After Curative Surgery in Cushing’s Disease and Its Predictor," by researchers at Huashan Hospital Fudan University, Shanghai, China, published on Research Square and provided to you by Medscape. This study has not yet been peer reviewed. The full text of the study can be found on researchsquare.com. Abstract Objective Patients with Cushing’s disease (CD) experienced transient central adrenal insufficiency (CAI) after successful surgery. However, the reported recovery time of hypothalamic-pituitary-adrenal (HPA) axis varied and the risk factors which could affect recovery time of HPA axis had not been extensively studied. This study aimed to analyze the duration of CAI and explore the risk factors affecting HPA axis recovery in post-operative CD patients with biochemical remission. Design and methods Medical records of diagnosis with CD in Huashan Hospital were reviewed between 2014 and 2020. 140 patients with biochemical remission and regular follow-up after surgery were enrolled in this retrospective cohort study according to the criteria. Demographic details, clinical and biochemical information at baseline and each follow-up (within 2 years) were collected and analyzed. Results Overall, 103 patients (73.6%) recovered from transient CAI within 2 years follow-up and the median recovery time was 12 months [95% confidence intervals (CI): 10–14]. The age and midnight ACTH at baseline were significantly lower, while the TT3 and FT3 levels were significantly higher in patients with recovered HPA compared to patients with CAI at 2-year follow-up(p < 0.05). In persistent CAI group, more patients underwent partial hypophysectomy. TT3 at diagnosis was an independent predictor of the recovery of HPA axis, even after adjusting for gender, age, duration, surgical history, maximum tumor diameter, surgical strategy, and postoperative nadir serum cortisol level (p = 0.04, OR: 6.03, 95% CI: 1.085, 22.508). Among patients with unrecovered HPA axis at 2-year follow-up, 23 CAI patients (62%) were accompanied by multiple pituitary axis dysfunction besides HPA axis, including hypothyroidism, hypogonadism, or central diabetes insipidus. Conclusion HPA axis recovered in 73.6% of CD patients within 2 years after successful surgery, and the median recovery time was 12 months. TT3 level at diagnosis was an independent predictor of postoperative recovery of HPA axis in CD patients. Moreover, patients coexisted with other hypopituitarism at 2-year follow-up had a high probability of unrecovered HPA axis. total triiodothyronine Cushing’s disease central adrenal insufficiency Read more at
  5. Abstract Cushing’s syndrome (CS) is a diagnosis used to describe multiple causes of serum hypercortisolism. Cushing’s disease (CD), the most common endogenous subtype of CS, is characterized by hypercortisolism due to a pituitary tumor secreting adrenocorticotropic hormone (ACTH). A variety of tests are used to diagnose and differentiate between CD and CS. Hypercortisolism has been found to cause many metabolic abnormalities including hypertension, hyperlipidemia, impaired glucose tolerance, and central adiposity. Literature shows that many of the symptoms of hypercortisolism can improve with a low carb (LC) diet, which consists of consuming <30 g of total carbohydrates per day. Here, we describe the case of a patient with CD who presented with obesity, hypertension, striae and bruising, who initially improved some of his symptoms by implementing a LC diet. Ultimately, as his symptoms persisted, a diagnosis of CD was made. It is imperative that practitioners realize that diseases typically associated with poor lifestyle choices, like obesity and hypertension, can often have alternative causes. The goal of this case report is to provide insight on the efficacy of nutrition, specifically a LC diet, on reducing metabolic derangements associated with CD. Additionally, we will discuss the importance of maintaining a high index of suspicion for CD, especially in those with resistant hypertension, obesity and pre-diabetes/diabetes. Keywords: low carb; carnivore; ketogenic; Cushing syndrome; Cushing disease; glucose intolerance; hypertension; obesity; metabolic health 1. Introduction Cushing’s syndrome (CS) is a rare disorder of hypercortisolism related to exposure to high levels of cortisol (>20 mcg/dL between 0600–0800 or >10 mcg/dL after 1600) for an extended period [1,2]. CS affects 10 to 15 people per million and is more common among those with diabetes, hypertension, and obesity [3]. The metabolic derangements associated with CS include visceral obesity, elevated blood pressure, dyslipidemia, type II diabetes mellitus (T2DM) and insulin resistance [4]. CS physical exam findings include round face, dorsal fat pad, central obesity, abdominal striae, acne, and ecchymosis [3]. Other symptoms associated with CS include low libido, headache, change in menses, depression and lethargy [2,3,5]. The most common features of CS are weight gain, which is found in 82% of cases, and hypertension, which is found in 50–85% of cases [6]. CS can be caused by exogenous glucocorticoids, known as iatrogenic CS, ectopic ACTH secretion (EAS) from sources like a small cell lung cancer or adrenal adenoma, known as EAS CS, or excess production of ACTH from a pituitary tumor, known as CD [3]. In CD, ACTH subsequently causes increased production of cortisol from the adrenal glands. CD accounts for 80–85% of endogenous cases of CS [3]. Other conditions including alcoholism, depression, severe obesity, bulimia and anorexia nervosa can lead to a Cushing-like state, although are not considered true CS [3]. Many studies have demonstrated that LC diets can ameliorate some of the most common metabolic derangements seen in CD, namely hyperglycemia, weight gain, hypertension and insulin resistance. A LC diet is a general term for diets which lower the total carbohydrates consumed per day [4]. A ketogenic diet is a subtype of LC that is described as having even fewer carbohydrates, typically less than 30 g/day. By reducing carbohydrate intake and thus limiting insulin production, the body achieves ketosis by producing an elevated number of ketones including β-hydroxybutyric acid, acetoacetic acid, and acetone, in the blood [7]. A carnivore diet, a specific type of a ketogenic diet, is defined as mainly eating animal food such as meat, poultry, eggs and fish. Contrarily, a standard American diet (SAD) is defined as a diet high in processed foods, carbs, added sugars, refined fats, and highly processed dairy products [8]. There are several therapeutic applications for LC diets that are currently supported by strong evidence. These include weight loss, cardiovascular disease, T2DM, and epilepsy. LC diets have clinical utility for acne, cancer, polycystic ovary syndrome (PCOS), and neurologic deficits [9]. In this case report, the patient endorsed initially starting a LC diet to address weight gain and high blood sugars that he noted on a glucometer. The patient noted a 35 pounds (lbs.) weight loss over the first 1.5 years on his LC diet, as well as improved blood pressure and in his overall health. He then adopted a carnivore diet but found that weight loss was difficult to maintain, although his body composition continued to improveand his clothes fit better. Later, he noted that his blood pressure would at times be poorly controlled despite multiple medications and strict dietary adherence. The patient reported “being in despair” and “not trusting his doctors” because they did not understand how much his diet had helped him. Despite strict adherence, his symptoms of insulin resistance and hypertension persisted. In this report, we will describe how his symptoms of CD were ameliorated by the ketogenic diet. This case report also highlights that when patients are unable to overcome hormonal pathology, clinicians should not blame patients for lack of adherence to a diet, but instead understand the need to evaluate for complex pathology. 2. Detailed Case Description A male patient in his thirties, of Asian descent, had a past medical history of easy bruising, central obesity, headaches, hematuria, and hypertension and past family medical history of hypertension in his father and brother. In 2015, he was at his heaviest weight of 179 lbs. with a body mass index (BMI) of 28 kg/m2, placing him in the overweight category (25.0–29.9 kg/m2). At that time the patient reported he was following a SAD diet and was active throughout the day. The patient stated he ate a diet of vegetables, fruits and carbohydrates, but he was not able to lose weight. The patient stated that he switched to a LC diet, to address weight gain and hyperglycemia, and he reported that he lost approximately 35 lbs. in 1.5 years. The patient described his LC diet as eating green leafy vegetables, low carb fruits, fish, poultry, beef and dairy products. The patient then later switched to a carnivore diet. He noted despite aggressively adhering to his diet, that his weight-loss had plateaued, although his waist circumference continued to decrease. The patient noted his carnivore diet consisted of eating a variety of different meats, poultry, fish and eggs. The metabolic markers seen in Table 1 were obtained after the patient had started a carnivore diet. The patient’s blood glucose levels decreased overtime despite impaired glucose metabolism being a known side effect of hypercortisolism [4]. The patient’s high-density lipoprotein (HDL) remained in a healthy range (40–59 mg/dL) and his triglycerides stayed in an optimal range (<100 mg/dL), despite dyslipidemia being a complication of CD [4]. When the patient was consuming a SAD diet, he was not under the care of a physician and was unable to provide us with previous biomarkers. Table 1. Patient’s metabolic markers on a carnivore diet. Glucose (70 to 99 mg/dL), total cholesterol (desirable <200 mg/dL, borderline high 200–239 mg/dL, high >239 mg/dL), triglycerides (optimal: <100 mg/dL), HDL (low male: <40 mg/dL), low density lipoprotein (LDL) (Optimal: <100 mg/dL). Despite strict adherence to his diet and initial improvement in his weight, his blood pressure and his blood sugar levels, in October of 2021 the patient was admitted to the hospital for hypertensive urgency, with a blood pressure of 216/155. His complaints at the time were unexplained ecchymosis, hematuria and significant headaches that were resistant to Excedrin (acetaminophen-aspirin-caffeine) use. At the hospital, the patient underwent a computed tomography (CT) scan of the head and radiograph of the chest, and both images were negative for acute pathology. During his hospital admission, the patient denied any changes in vision, chest pain or edema of the legs. Ultimately, the patient was told to eat a low-salt diet and to follow-up with a cardiologist. At discharge, the patient was placed on hydrochlorothiazide, labetalol, amlodipine and lisinopril. The patient was then seen by his primary care physician in November of 2021 and his urinalysis at that time showed 30 mg/mL (Negative/Trace) of protein in his urine, without hematuria. The patient’s primary care physician discontinued his hydrochlorothiazide and started the patient on furosemide. Additionally, the primary care physician reinforced cutting out salt and limiting his calories to prevent any further weight gain, which his physician explained would contribute further to his hypertension. He was referred to hematology and oncology in November of 2021 for his symptoms of hematuria and abnormal ecchymosis to his abdomen, thighs and arms. The patient’s coagulation and platelet counts were normal, and his symptoms were noted to be improving. His hematuria and ecchymosis were attributed to his significant Excedrin use from the past 1–2 months, secondary to his headaches, and their anti-platelet effect. It was noted that the patient had significant hemolysis during his hospital admission. However, in his follow up examination, there were no signs of hemolysis, and it was attributed to his hypertensive urgency. Again, a low-salt, calorie-limited diet was recommended. The patient was referred to cardiology where he was evaluated for secondary hypertension, because despite his weight loss and his strict adherence to his diet, his blood pressure was still uncontrolled on multiple medications. He had a normal echocardiogram and renal ultrasound which showed no signs of renal artery stenosis bilaterally. At that time the patient’s serum renin, aldosterone and urine metanephrine levels were all normal. His cardiologist increased his lisinopril, and continued him on amlodipine, furosemide and labetalol and reinforced the recommendations of lowering his salt and preventing weight gain. The patient first contacted our office in January of 2022. At that time his blood pressure was noted to be 160/120 despite being compliant with current blood pressure medications. The patient reported strict adherence to his carnivore diet by sharing his well-documented meals on his social media accounts. Given the persistent symptoms, despite his significant change in diet and weight loss, we were concerned that a hormonal etiology may be driving his symptoms. The patient was seen in-person, in our office, in March of 2022. At the request of the patient, we again reviewed his social media profile to assess his meal choices and diet. While the patient was eager to show us his carnivore meals, what we incidentally noted in his photos was despite weight loss and strict diet adherence, he had developed moon facies (Figure 1a,b). On the physical exam, we noted his prominent abdominal striae (Figure 2). Several screening tests for Cushing’s syndrome were ordered. A midnight salivary cortisol was ordered, with values of 0.884 ug/dL (<0.122 ug/dL) and 0.986 ug/dL (<0.122 ug/dL) and a urinary free cortisol excretion (UFC) was ordered, with values of 8.8 ug/L (5–64 ug/L). At this point our suspicion was confirmed that the patient had inappropriately elevated cortisol. Figure 1. The patient’s progression of moon facies, (a) photo from 2019 after initial weight loss (b) photo from office visit in 2022. Figure 2. The arrows demonstrate early striae visualized on the lower abdomen bilaterally, unclear in image due to poor office lighting. Based on screening tests and significant physical exam findings, we referred the patient to endocrinology for a low dose dexamethasone suppression test (DST). They performed a low dose DST revealing a dehydroepiandrosterone (DHEA) of 678 ug/dL (89–427 ug/dL) and ACTH of 23.9 pg/mL (7.2–63.3 pg/mL). The low dose DST and midnight salivary cortisol were both positive indicating hypercortisolism. To begin determining the source of hypercortisolism, the plasma ACTH was evaluated and was 27.2 pg/mL (7.2–63.3 pg/mL). While ACTH was within normal range, a plasma ACTH > 20 pg/mL is suggestive of ACTH-dependent CS, so a magnetic resonance imaging (MRI) of the brain was ordered [2]. The MRI revealed a 4 mm heterogeneous lesion in the central pituitary gland which is suspicious of a cystic microadenoma. To confirm that a pituitary tumor was the cause of the patient’s increased cortisol, the patient was sent for inferior petrosal sinus sampling (IPSS). The results of the IPSS indicated an increase in ACTH in both inferior petrosal sinuses and peripheral after corticotropin-releasing hormone (CRH) stimulation (Figure 3a–c), which was consistent with hypercortisolism. Figure 3. (a) Right IPS venous sampling values for ACTH and prolactin after CRH stimulation over multiple time intervals. (b) Left IPS venous sampling values for ACTH and prolactin after CRH stimulation over multiple time intervals. (c) Peripheral sampling values for ACTH and prolactin after CRH stimulation over multiple time intervals. Lab results from the patient’s IPSS venous sampling can be seen above. The graphs depict the lab values of ACTH (7.2–63.3 pg/mL) and prolactin (PRL) (2.1–17.7 ng/mL) before and after CRH stimulation during IPSS. PRL acts as a baseline to indicate successful catheterization in the procedure [10]. Using the ACTH levels from our patient’s IPSS we calculated a ratio of inferior petrosal sinus to peripheral (IPS:P). These results can be seen below (Table 2). The right IPS:P was calculated as 3.60 at 10 min and the left IPS:P as 7.65 at 10 min. These ratios confirmed that the hypercortisolism was due to the pituitary tumor, as it is higher than the 3:1 ratio necessary for diagnosis of CD [11]. The patient is currently scheduled to undergo surgical resection of the pituitary microadenoma. Table 2. Right and left petrosal sinus to peripheral serum ACTH ratios. 3. Clinical Evaluation for CS In this case, the patient presented with uncontrolled hypertension, weight gain despite a strict diet, hyperglycemia, abdominal striae and moon facies. Despite evaluation, both inpatient and outpatient, a diagnosis of CS was not yet explored. When CS is suspected based on clinical findings, the use of exogenous steroids must first be excluded as it is the most common cause of hypercortisolism [3]. If there is still concern for CS, there are three screening tests that can be done which are sensitive but not specific for hypercortisolism. The screening tests include: a 24-h UFC, 2 late night salivary cortisol tests, low dose (1 g) DST [3]. To establish the preliminary diagnosis of hypercortisolism two screening tests must be abnormal [2]. The first step to determine the cause of hypercortisolism is to measure the plasma level of ACTH. Low values of ACTH < 5 pg/mL indicate the cause is likely ACTH-independent CS and imaging of the adrenal glands is warranted as there is a high suspicion of an adrenal adenoma [2,3]. When the serum ACTH is elevated >/20 pg/mL it is likely an ACTH-dependent form of CS [2]. To further evaluate an ACTH-dependent hypercortisolism, an MRI should be obtained as there is high suspicion that the elevated cortisol is coming from a pituitary adenoma. If there is a pituitary mass >6 mm there is a strong indication for the diagnosis of CD [2]. However, pituitary tumors can be quite small and can be missed on MRIs in 20–58% of patients with CD [2]. If there is still a high suspicion of CD with an inconclusive MRI, a high dose DST (8 g) is done. Patients with CD should not respond and their ACTH and DHEA, a steroid precursor, should remain high. Similarly, CRH stimulation test is done and patients with CD should have an increase in ACTH and/or cortisol within 45 min of CRH being given. If the patient has a positive high-dose DST, CRH-stimulation test and an MRI with a pituitary tumor >6 mm no further testing is needed as it is likely the patient has CD [2]. If either of those tests are abnormal, the MRI shows a pituitary tumor < 6 mm, or there is diagnostic ambiguity, the patient should undergo IPSS with ACTH measurements before and after the administration of CRH [4]. IPSS is the gold standard for determining the source of ACTH secretion and confirming CD. In this invasive procedure, ACTH, prolactin, and cortisol levels are sampled prior to CRH stimulation and after CRH stimulation. PRL acts as a baseline to indicate successful catheterization in the procedure [12]. To confirm CD, a ratio of IPS:P is calculated for values prior to and after CRH stimulation. A peak ratio greater than 2.0 before CRH stimulation or a peak ratio greater than 3.0 after CRH stimulation is indicative of CD. In comparing the right and left petrosal sinus sample, an IPS:P ratio greater than 1.4 suggests adenoma lateralization. However, due to high variability, IPSS should not be used for diagnosing lateralization [13]. 4. Discussion Surgical intervention remains the primary treatment for CD [4]. However, remission is not guaranteed as symptoms and metabolic diseases have been shown to persist afterwards. In the literature it has been shown that nutrition can have a powerful impact on suppressing, or even reversing metabolic disorders and comorbidities associated with CD. A LC diet has been shown to promote significant weight loss, reduce hypertension, improve dyslipidemia, reverse T2DM and improve cortisol levels (2, 14–15, 18–21). There are reports of weight loss on a LC diet in the literature. A LC significantly reduced weight and BMI of 30 male subjects [14]. In a group of 120 participants over 24 weeks who followed a LC versus low fat (LF) diet, showed a greater weight loss in the LC group vs. the LF group [15]. Patients diagnosed and treated for CD found that their weight remained largely unchanged even after treatment [6]. In many cases, surgical treatment does not always resolve the associated comorbidity of central adiposity in CD. In such cases, a LC diet can be used before, during and after treatment, as an adjunct, to decrease associated weight gain and comorbidities. Nutritional intervention can be a powerful adjunct to reduce comorbidities associated with CD. As seen in this case report, the patient’s symptoms of CD, especially hypertension and weight gain, improved with dietary changes despite him having a pituitary microadenoma. Multiple studies showed that a LC diet was able to decrease blood pressure parameters. In a group of 120 participants over 24 weeks who followed a LC versus a LF diet showed a greater decrease in both systolic and diastolic blood pressure in the LC group vs. the LF group [15]. Other literature which studied the effect of a LC diet on hypertension demonstrated the reduction of blood pressure and is thought to be due to ketogenesis. It is thought the production of ketones have a natriuretic effect on the body therefore lowering systemic blood pressure [16]. A LC diet improves lipid profiles and inflammatory markers associated with metabolic syndrome [14]. Literature shows that a LC diet has a greater impact on decreasing triglyceride levels and increasing HDL levels, when compared to a LF diet [15]. Triglyceride levels in patients in CD remission remained high [17]. Therefore, it can be hypothesized that a LC diet would be beneficial, in addition to standard CD treatment, to lower the associated comorbidity of hypertriglyceridemia and metabolic syndrome. Insulin resistance, a precursor to T2DM, is a common comorbidity of hypercortisolism which can be treated with a LC diet. One study showed that in subjects with T2DM, a decrease in A1c and a reduction in antidiabetic therapy were seen with consumption of a LC diet [18]. Additionally, a cohort of 9 participants following a LC diet were able to collectively lower their A1c on average by 1% while concurrently discontinuing various antidiabetic therapies including insulin [19]. Literature shows that a LC diet can minimize systemic cortisol levels through various mechanisms. Current treatment of CD includes medications which block cortisol production and/or cortisol secretion [2]. LC can imitate similar results seen through medication intervention for CD. Carbohydrate restriction can lower cortisol levels, as carbohydrates stimulate adrenal cortisol secretion and extra-adrenal cortisol regeneration [4]. A ketogenic diet can lower the level of ghrelin, a peptide produced in the stomach that has orexigenic properties [20,21]. Literature shows that ghrelin increases levels of serum cortisol [22]. Therefore, implementing a ketogenic diet would decrease ghrelin, and subsequently minimize the effects of increased ghrelin on serum cortisol. A LC diet decreases visceral fat which itself is an endocrine organ and can increase the synthesis of cortisol [14]. Therefore, decreasing visceral fat also decreases the production of cortisol. A LC was shown to significantly reduced weight, BMI and cortisol levels of 30 obese male subjects [14]. Further, a LC diet excludes foods with a high glycemic index which cause increased stress on the body which subsequently leads to the activation of the hypothalamic-pituitary-axis which causes increased levels of cortisol [14]. This case report illustrated how a LC diet was initially successful at ameliorating the patient’s associated symptoms of hypertension and obesity, making his diagnosis of CD go undetected. Literature shows that while the prevalence of CS on average is a fraction of a percent, it is much higher among patients with poorly controlled diabetes, hypertension and early onset osteoporosis [3]. Two hundred patients with diabetes mellitus were studied and 5.5% were found to have CS [23]. Another study discovered that in subjects with CD, 36.4% were found to have hyperlipidemia, 73.1% with hypertension, and 70.2% with impaired glucose metabolism [17]. It can be concluded that a higher index of suspicion and lower threshold for screening for CS may be necessary in obese and diabetic patient populations. A lower threshold for screening can allow for earlier diagnosis for many patients, and therefore provide better outcomes for those diagnosed with CS. It is important for clinicians to consider alternative pathology for patients combating metabolic derangements. As depicted in this case, the patient lost 35 lbs. while on a LC diet, despite having hypercortisolism, presumably for months to years prior to the diagnosis of his condition. The patient noted a tendency to gain weight, have elevated blood sugar and blood pressure which prompted him to begin self-treatment with increasingly strict carbohydrate restriction. The patient was able to keep his symptoms of hypercortisolism managed, potentially making the diagnosis difficult for his team of clinicians. From a diagnostic perspective, it’s important to understand that strict dietary adherence can have profound impacts on even the most severe hormonal pathology. Ultimately, this case serves as a reminder of the power of nutrition to address metabolic derangements and simultaneously as a reminder to diagnosticians to never rely on lack of dietary adherence as a reason for persistent metabolic symptoms. The reflexive advice to “not gain weight” and “lower salt intake” in retrospect appears both dogmatic and careless. In this case, the patient had seen several doctors and was even hospitalized and yet his disease state remained unclear and the dietary messaging cursory. 5. Conclusions Many chronic diseases, including diabetes, hypertension and obesity, are generally thought to be caused by dietary and lifestyle choices. However, as exemplified in this report underlying medical problems, such as endocrine disorders, can be the cause of such metabolic derangements. It is critical that practitioners consider other causes of metabolic derangements, as assuming that they are due to poor dietary adherence, can allow them to go undiagnosed. While there is extensive literature on LC diets and their effect on the metabolic derangements associated with hypercortisolism, there needs to be further research on LC as an adjunctive therapy to conventional CD treatment. Ultimately, nutrition can have a powerful impact on suppressing, or even reversing metabolic disorders. As depicted in this case study, a LC diet is powerful enough to temporarily suppress symptoms of CD. Author Contributions M.K.D., E.-C.P.-M. and T.K. equally contributed to this case report. All authors have read and agreed to the published version of the manuscript. Funding This research received no external funding. Institutional Review Board Statement Not applicable. Informed Consent Statement Written informed consent has been obtained from the patient to publish this paper. Data Availability Statement The data presented in this study are available in article. Acknowledgments We would like to thank our patients and the Society of Metabolic Health Practitioners. Conflicts of Interest T.K. is an unpaid member of the Board of Directors of the Society of Metabolic Health Practitioners and a producer of podcasts on health and nutrition, with all proceeds donated to humanitarian charities; his spouse has ownership interest in a food company. The other author reports no conflicts of interest. References Nieman, L.K. UpToDate. Available online: https://www.uptodate.com/contents/measurement-of-cortisol-in-serum-and-saliva?search=cortisol%20level&source=search_result&selectedTitle=1~150&usage_type=default&display_rank=1 (accessed on 27 September 2022). Feelders, R.; Sharma, S.; Nieman, L. Cushing’s Syndrome: Epidemiology and Developments in Disease Management. Clin. Epidemiol. 2015, 7, 281. [Google Scholar] [CrossRef] [PubMed] Guaraldi, F.; Salvatori, R. Cushing Syndrome: Maybe Not so Uncommon of an Endocrine Disease. J. Am. Board Fam. Med. 2012, 25, 199–208. [Google Scholar] [CrossRef] [PubMed] Guarnotta, V.; Emanuele, F.; Amodei, R.; Giordano, C. Very Low-Calorie Ketogenic Diet: A Potential Application in the Treatment of Hypercortisolism Comorbidities. Nutrients 2022, 14, 2388. [Google Scholar] [CrossRef] [PubMed] Nieman, L.K. UpToDate. Available online: https://www.uptodate.com/contents/epidemiology-and-clinical-manifestations-of-cushings-syndrome?search=cushings%20diagnosis%20symptoms&source=search_result&selectedTitle=2~150&usage_type=default&display_rank=2 (accessed on 27 September 2022). Schernthaner-Reiter, M.H.; Siess, C.; Gessl, A.; Scheuba, C.; Wolfsberger, S.; Riss, P.; Knosp, E.; Luger, A.; Vila, G. Factors Predicting Long-Term Comorbidities in Patients with Cushing’s Syndrome in Remission. Endocrine 2018, 64, 157–168. [Google Scholar] [CrossRef] [PubMed] Giordano, C.; MarchiÃ2, M.; Timofeeva, E.; Biagini, G. Neuroactive Peptides as Putative Mediators of Antiepileptic Ketogenic Diets. Front. Neurol. 2014, 5, 63. [Google Scholar] [CrossRef] Standard American Diet (SAD). Available online: https://piviohealth.com/knowledge-bank/glossary/standard-american-diet-sad/ (accessed on 2 October 2022). Paoli, A.; Rubini, A.; Volek, J.S.; Grimaldi, K.A. Beyond Weight Loss: A Review of the Therapeutic Uses of Very-Low-Carbohydrate (Ketogenic) Diets. Eur. J. Clin. Nutr. 2013, 67, 789–796. [Google Scholar] [CrossRef] [PubMed] Sharma, S.T.; Nieman, L.K. Is Prolactin Measurement of Value during Inferior Petrosal Sinus Sampling in Patients with ACTH-Dependent Cushing’s Syndrome? J. Endocrinol. Investig. 2013, 36, 1112–1116. [Google Scholar] [CrossRef] Kline, G.; Chin, A.C. Chapter 5—Adrenal disorders. In Endocrine Biomarkers: Clinical Aspects and Laboratory Determination; Elsevier: Amsterdam, The Netherlands, 2017; Available online: https://www.sciencedirect.com/science/article/pii/B9780128034125000057 (accessed on 18 October 2022). Ghorbani, M.; Akbari, H.; Griessenauer, C.J.; Wipplinger, C.; Dastmalchi, A.; Malek, M.; Heydari, I.; Mollahoseini, R.; Khamseh, M.E. Lateralization of Inferior Petrosal Sinus Sampling in Cushing’s Disease Correlates with Cavernous Sinus Venous Drainage Patterns, but Not Tumor Lateralization. Heliyon 2020, 6, e05299. [Google Scholar] [CrossRef] Knecht, L. Inferior Petrosal Sinus Sampling in the Diagnosis of Cushing’s Disease. Available online: https://csrf.net/doctors-articles/inferior-petrosal-sinus-sampling-diagnosis-cushings-disease/ (accessed on 18 October 2022). Polito, R.; Messina, G.; Valenzano, A.; Scarinci, A.; Villano, I.; Monda, M.; Cibelli, G.; Porro, C.; Pisanelli, D.; Monda, V.; et al. The Role of Very Low Calorie Ketogenic Diet in Sympathetic Activation through Cortisol Secretion in Male Obese Population. J. Clin. Med. 2021, 10, 4230. [Google Scholar] [CrossRef] [PubMed] Yancy, W.S.; Olsen, M.K.; Guyton, J.R.; Bakst, R.P.; Westman, E.C. A Low-Carbohydrate, Ketogenic Diet versus a Low-Fat Diet to Treat Obesity and Hyperlipidemia. Ann. Intern. Med. 2004, 140, 769. [Google Scholar] [CrossRef] [PubMed] Khan, S.S.; Ning, H.; Wilkins, J.T.; Allen, N.; Carnethon, M.; Berry, J.D.; Sweis, R.N.; Lloyd-Jones, D.M. Association of Body Mass Index with Lifetime Risk of Cardiovascular Disease and Compression of Morbidity. JAMA Cardiol. 2018, 3, 280–287. [Google Scholar] [CrossRef] Sun, X.; Feng, M.; Lu, L.; Zhao, Z.; Bao, X.; Deng, K.; Yao, Y.; Zhu, H.; Wang, R. Lipid Abnormalities in Patients with Cushing’s Disease and Its Relationship with Impaired Glucose Metabolism. Front. Endocrinol. 2021, 11, 600323. [Google Scholar] [CrossRef] [PubMed] Bolla, A.; Caretto, A.; Laurenzi, A.; Scavini, M.; Piemonti, L. Low-Carb and Ketogenic Diets in Type 1 and Type 2 Diabetes. Nutrients 2019, 11, 962. [Google Scholar] [CrossRef] [PubMed] Norwitz, N.G.; Soto-Mota, A.; Kalayjian, T. A Company Is Only as Healthy as Its Workers: A 6-Month Metabolic Health Management Pilot Program Improves Employee Health and Contributes to Cost Savings. Metabolites 2022, 12, 848. [Google Scholar] [CrossRef] [PubMed] Ebbeling, C.B.; Feldman, H.A.; Klein, G.L.; Wong, J.M.W.; Bielak, L.; Steltz, S.K.; Luoto, P.K.; Wolfe, R.R.; Wong, W.W.; Ludwig, D.S. Effects of a Low Carbohydrate Diet on Energy Expenditure during Weight Loss Maintenance: Randomized Trial. BMJ 2018, 363, k4583. [Google Scholar] [CrossRef] [PubMed] Marchiò, M.; Roli, L.; Lucchi, C.; Costa, A.M.; Borghi, M.; Iughetti, L.; Trenti, T.; Guerra, A.; Biagini, G. Ghrelin Plasma Levels after 1 Year of Ketogenic Diet in Children with Refractory Epilepsy. Front. Nutr. 2019, 6, 112. [Google Scholar] [CrossRef] [PubMed] Kärkkäinen, O.; Farokhnia, M.; Klåvus, A.; Auriola, S.; Lehtonen, M.; Deschaine, S.L.; Piacentino, D.; Abshire, K.M.; Jackson, S.N.; Leggio, L. Effect of Intravenous Ghrelin Administration, Combined with Alcohol, on Circulating Metabolome in Heavy Drinking Individuals with Alcohol Use Disorder. Alcohol. Clin. Exp. Res. 2021, 45, 2207–2216. [Google Scholar] [CrossRef] [PubMed] Catargi, B.; Rigalleau, V.; Poussin, A.; Ronci-Chaix, N.; Bex, V.; Vergnot, V.; Gin, H.; Roger, P.; Tabarin, A. Occult Cushing’s Syndrome in Type-2 Diabetes. Available online: https://academic.oup.com/jcem/article/88/12/5808/2661485 (accessed on 27 September 2022). Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). From https://www.mdpi.com/2218-1989/12/11/1033/htm
  6. Objective: This extended evaluation (EE) of the SONICS study assessed effects of levoketoconazole for an additional 6 months following open-label, 6-month maintenance treatment in endogenous Cushing’s syndrome. Design/Methods: SONICS included dose-titration (150–600 mg BID), 6-month maintenance, and 6-month EE phases. Exploratory efficacy assessments were performed at Months 9 and 12 (relative to start of maintenance). For pituitary MRI in patients with Cushing’s disease, a threshold of ≥2 mm denoted change from baseline in largest tumor diameter. Results: Sixty patients entered EE at Month 6; 61% (33/54 with data) exhibited normal mean urinary free cortisol (mUFC). At Months 9 and 12, respectively, 55% (27/49) and 41% (18/44) of patients with data had normal mUFC. Mean fasting glucose, total and LDL-cholesterol, body weight, body mass index, abdominal girth, hirsutism, CushingQoL, and BDI-II scores improved from study baseline at Months 9 and 12. Forty-six patients completed Month 12; 4 (6.7%) discontinued during EE due to adverse events. The most common adverse events in EE were arthralgia, headache, hypokalemia, and QT prolongation (6.7% each). No patient experienced ALT or AST >3× ULN, QTcF interval >460 msec, or adrenal insufficiency during EE. Of 31 patients with tumor measurements at baseline and Month 12 or follow-up, largest tumor diameter was stable in 27 (87%) patients, decreased in 1, and increased in 3 (largest increase 4 mm). Conclusion: In the first long-term levoketoconazole study, continued treatment through 12-month maintenance period sustained the early clinical and biochemical benefits in most patients completing EE, without new adverse effects. Read the whole article at https://eje.bioscientifica.com/configurable/content/journals$002feje$002faop$002feje-22-0506$002feje-22-0506.xml?t%3Aac=journals%24002feje%24002faop%24002feje-22-0506%24002feje-22-0506.xml&body=pdf-45566
  7. Abstract (1) Background: Cushing’s disease (CD) is a serious endocrine disorder caused by an adrenocorticotropic hormone (ACTH)-secreting pituitary neuroendocrine tumor (PitNET) that stimulates the adrenal glands to overproduce cortisol. Chronic exposure to excess cortisol has detrimental effects on health, including increased stroke rates, diabetes, obesity, cognitive impairment, anxiety, depression, and death. The first-line treatment for CD is pituitary surgery. Current surgical remission rates reported in only 56% of patients depending on several criteria. The lack of specificity, poor tolerability, and low efficacy of the subsequent second-line medical therapies make CD a medical therapeutic challenge. One major limitation that hinders the development of specific medical therapies is the lack of relevant human model systems that recapitulate the cellular composition of PitNET microenvironment. (2) Methods: human pituitary tumor tissue was harvested during transsphenoidal surgery from CD patients to generate organoids (hPITOs). (3) Results: hPITOs generated from corticotroph, lactotroph, gonadotroph, and somatotroph tumors exhibited morphological diversity among the organoid lines between individual patients and amongst subtypes. The similarity in cell lineages between the organoid line and the patient’s tumor was validated by comparing the neuropathology report to the expression pattern of PitNET specific markers, using spectral flow cytometry and exome sequencing. A high-throughput drug screen demonstrated patient-specific drug responses of hPITOs amongst each tumor subtype. Generation of induced pluripotent stem cells (iPSCs) from a CD patient carrying germline mutation CDH23 exhibited dysregulated cell lineage commitment. (4) Conclusions: The human pituitary neuroendocrine tumor organoids represent a novel approach in how we model complex pathologies in CD patients, which will enable effective personalized medicine for these patients. Keywords: organoids; neuroendocrine tumors; induced pluripotent stem cells; CDH23 1. Introduction Cushing’s disease (CD) is a serious endocrine disorder caused by an adrenocorticotropic hormone (ACTH)-secreting pituitary neuroendocrine tumor (PitNET) that stimulates the adrenal glands to overproduce cortisol [1,2,3,4]. The WHO renamed pituitary adenomas as PitNETs [5]. While PitNETs have been defined as benign, implying that these tumors cause a disease that is not life threatening or harmful to health, in fact chronic exposure to excess cortisol has wide-ranging and detrimental effects on health. Hypercortisolism causes increased stroke rates, diabetes, obesity, depression, anxiety, and a three-fold increase in the risk of death from cardiovascular disease and cancer [4,6,7,8]. The first-line treatment for CD is pituitary surgery, which is followed by disease recurrence in 50% of patients during the 10-year follow-up period after surgery in the hands of an experienced surgeon [9,10,11]. Studies have demonstrated that surgical failures and recurrences of CD are common, and despite multiple treatments, biochemical control is not achieved in approximately 30% of patients. This suggests that in routine clinical practice, initial and long-term disease remission is not achieved in a substantial number of CD patients [7,12]. Hence, medical therapy is often considered in the following situations: when surgery is contraindicated or fails to achieve remission, or when recurrence occurs after apparent surgical remission. While stereotactic radiosurgery treats incompletely resected or recurrent PitNETs, the main drawbacks include the longer time to remission (12–60 months) and the risk of hypopituitarism [3,13,14]. There is an inverse relationship between disease duration and reversibility of complications associated with the disease, thus emphasizing the importance of identifying an effective medical strategy to rapidly normalize cortisol production by targeting the pituitary adenoma [4,7,12]. Unfortunately, the lack of current standard of care treatments with low efficacy and tolerability makes CD a medical therapeutic challenge. The overall goal of medical therapy for CD is to target the signaling mechanisms to lower cortisol levels in the body [15,16]. The drugs offered for treatment of CD vary in the mechanism of action, safety, tolerability, route of administration, and drug–drug interactions [15,16]. In the era of precision medicine [17], where it is imperative to identify effective therapies early, there is an urgent need to accelerate the identification of therapies targeted to the ACTH-secreting pituitary tumor which are tailored for each individual patient. The absence of preclinical models that replicate the complexity of the PitNET microenvironment has prevented us from acquiring the knowledge to advance clinical care by implementing therapies specifically targeting the tumor, which would have a higher efficacy and tolerability for CD patients. In this instance, organoids can replicate much of the complexity of an tumor. An “organoid” is defined as a three-dimensional cell structure, grown from primary cells of dissociated pituitary tumors in Matrigel matrix, which proliferate, and differentiate in three dimensions, eventually replicating key biological properties of the tissue [18]. While pituitary cell lines predominantly represent hormonal lineages, these cultures do not reproduce the primary pituitary tissue because of the tumor transformation and non-physiological 2D culture conditions [19,20,21]. Pituitary tissue-derived organoids have been generated from mouse models [22,23]. While several human and rat pituitary spheroid/aggregate/tumoroid models have been reported, these cultures consist of poorly differentiated cells with high replicative potential which can affect drug response and produce data that poorly translate to the clinic [24,25]. In this study, we developed an organoid model derived from human PitNETs that replicated much of the cellular complexity and function of the patient’s tumor. Organoids derived from corticotroph PitNETs retained the genetic alterations of the patient’s primary tissue. 2. Materials and Methods 2.1. Generation and Culture of Human Pituitary Neuroendocrine Tumor (PitNET) Organoids Patients with planned transsphenoidal surgery for pituitary tumors were identified in the outpatient neurosurgery clinics. Tissues were collected under the St. Joseph’s Hospital and Barrow Neurological Institute Biobank collection protocol PHXA-05TS038 and collection of outcomes data protocol PHXA-0004-72-29, with the approval of the Institutional Review Board (IRB) and patient consent. Samples were de-identified and shipped to the Zavros laboratory (University of Arizona) for processing. Pituitary tumor tissue was collected in Serum-Free Defined Medium (SFDM) supplemented with ROCK inhibitor (Y27632, 10 µM), L-glutamine (2 mM), A83-01 (activin receptor-like kinase (Alk) 4/5/7 inhibitor, 0.5 mM), penicillin/streptavidin (1%), kanamycin (1%), amphotericin/gentamycin (0.2%), CHIR-98014 (4 mM), and thiazovivin (TZV, 2.5 mM). Tissues that contained red blood cells were incubated with Red Blood Cell (RBC) Lysis Buffer according to the manufacturer’s protocol (Thermo Fisher Scientific, San Fransisco, CA, USA). Tissues were dissected into small pieces, transferred to digestion buffer (DMEM/F12 supplemented with 0.4% collagenase 2, 0.1% hyaluronic acid, 0.03% trypsin-EDTA) and incubated for 5–10 min at 37 °C with gentle shaking. Tissue was further incubated with Accutase™ (Thermo Fisher Scientific) for 5 min at 37 °C. Enzymatically dissociated cells were pelleted and washed in DPBS supplemented with antibiotics at a 400 relative centrifugal force (RCF) for 5 min. Dissociated adenoma cells were resuspended in Matrigel™, and Matrigel™ domes containing the cells were then plated in culture dishes and overlaid with pituitary growth media (Supplemental Table S1). The culture was maintained at 37 °C at a relative humidity of 95% and 5% CO2. Organoid growth medium was replenished every 3–4 days and passaged after 15 days in culture. 2.2. Generation of Induced Pluripotent Stem Cells (iPSCs) Induced pluripotent stem cell lines (iPSC lines) were generated from control individuals (no reported disease) or CD patients according to published protocols by the University of Arizona iPSC Core [26]. All human iPSC lines were tested and found to be negative for mycoplasma contamination using the Mycoalert Mycoplasma testing kits (LT07-318, Lonza), and no karyotype abnormalities were found (KaryoStat+, Thermo). 2.3. Pituitary Organoids Generated from iPSCs Six well culture plates were coated with 2 mL/well 0.67% Matrigel (diluted in E8 media, UA iPSC core, 151169-01) and incubated at 37 °C at a relative humidity of 95% and 5% CO2 overnight. The iPSC lines were reprogrammed from the blood of either a healthy donor (JCAZ001) or a CD patient (iPSC7 and iPSC1063) at the University of Arizona iPSC Core. Passage 12 iPSCs were plated onto the coated plates and incubated at 37 °C at a relative humidity of 95% and 5% CO2. At 70% confluency, cells were passaged to freshly coated 24 well plates at a ratio of 1:8 and grown to 85–90% confluency before beginning the directed differentiation schedule. From days 0 to 3, cells were cultured in E6 media supplemented with 1% penicillin/streptomycin, 10 μM SB431542, and 5 ng/mL BMP4. BMP4 was withdrawn from the culture at day 3. Starting on day 4, the cells were cultured in E6 media, supplemented with 10 μM SB431542, 30 ng/mL human recombinant SHH, 100 ng/mL FGF8b, 10 ng/mL FGF18, and 50 ng/mL FGF10. Fifteen days after culture, the cells were harvested in cold E6 media by pipetting and resuspended in Matrigel™ (20,000 cells/50 mL Matrigel™). Matrigel™ domes containing the cells were plated in culture dishes and overlaid with differentiation media containing E6 media which was supplemented with 10 μM Y-27632, 30 ng/mL human recombinant SHH, 100 ng/mL FGF8b, 10 ng/mL FGF18, and 50 ng/mL FGF10 (Supplemental Table S2). Organoids were cultured for a further 15 days at 37 °C at a relative humidity of 95% and 5% CO2. 2.4. Spectral Flow Cytometry (Cytek™ Aurora) The multicolor flow cytometry panel was designed using the Cytek® Full Spectrum Viewer online tool to calculate the similarity index (Supplemental Figure S1). The organoids were harvested in cold SFDM media and centrifuged at 400× g for 5 min. Supernatant was discarded and organoids were dissociated to single cells using Accutase® (Thermo Fisher Scientific 00-4555-56). The enzymatic reaction was stopped using prewarmed DPBS, and cells were then centrifuged at 400× g for 5 min and incubated with fluorochrome-conjugated/unconjugated primary surface or cytoplasmic antibodies (Supplemental Figure S1) at 4 °C for 30 min. Cells were then washed with Cell Staining Buffer (BioLegend # 420-201) and incubated with secondary antibodies (Supplemental Figure S1) at 4 °C for 30 min. Cells were fixed using Cytofix/Cytoperm™ Fixation/Permeabilization Solution (BD Biosciences # 554714) at 4 °C for 20 min, followed by washing with Fixation/Permeabilization wash buffer. Cells were labeled with fluorochrome-conjugated/unconjugated intracellular primary antibodies (Supplemental Figure S1) at 4 °C for 30 min, then washed and incubated with secondary antibodies at 4 °C for 30 min. Cells were resuspended in cell staining buffer and fluorescence and measured using the Cytek Aurora 5 Laser Spectral Flow Cytometer. An unstained cell sample was fixed and used as a reference control. UltraComp eBeads™, Compensation Beads (Thermo Fisher Scientific # 01-2222-42) were stained with the individual antibodies and used as single stain controls for compensation and gating. Data were acquired using the Cytek™ Aurora and analyzed using Cytobank software (Beckman Coulter, Indianapolis, IN, USA). 2.5. Whole Mount Immunofluorescence Organoids were immunostained using published protocols by our laboratory [27,28,29]. Proliferation was measured by using 5-ethynyl-2′-deoxyuridine (EdU) incorporation according to the Manufacturer’s protocol (Click-IT EdU Alexa Fluor 555 Imaging Kit, Thermo Fisher Scientific C10338). Co-staining was performed by blocking fixed organoids with 2% donkey serum (Jackson Immuno Research, # 017-000-121) diluted in 0.01% PBST for 1hr at room temperature. Organoids were then incubated overnight at 4 °C with primary antibodies, followed by secondary antibodies and Hoechst (Thermo Fisher Scientific H1399, 1:1000 in 0.01% PBST) for 1 h at room temperature. Human specific primary antibodies used included: rabbit anti-ACTH (Thermo Fisher Scientific 701293, 1:250), rabbit anti-Synaptophysin (Thermo Fisher Scientific PA5-27286, 1:100), species PIT1 (Thermo Fisher Scientific PA5-98650, 1:50), rabbit anti-LH (Thermo Fisher Scientific PA5-102674, 1:100), mouse anti-FSH (Thermo Fisher Scientific MIF2709, 1:100), mouse anti-PRL (Thermo Fisher Scientific CF500720, 1:100), Alexa Flour conjugated GH (NB500-364AF647, 1:100), and mouse anti-CAM5.2 (SIGMA 452M-95, 1:250). The secondary antibodies used included Alexa Fluor 488 Donkey Anti Rabbit IgG (H+L) (Thermo Fisher Scientific A21206, 1:100) or Alexa Fluor 647 Donkey Anti Mouse IgG (H+L) (Thermo Fisher Scientific A31571, 1:100). Organoids were visualized and images were acquired by confocal microscopy using the Nikon CrestV2 Spinning Disk (Nikon, Melville, NY, USA). Fluorescence intensity and percentage of EdU positive cells of total cells, were calculated using Nikon Elements Software (Version 5.21.05, Nikon, Melville, NY, USA). 2.6. Nuclear Morphometric Analysis (NMA) Nuclear Morphometric Analysis (NMA) using treated organoids was performed based on a published protocol that measures cell viability based on the changes in nuclear morphology of the cells, using nuclear stain Hoechst or DAPI [30]. Images of organoid nuclei were analyzed using the ImageJ Nuclear Irregularity Index (NII) plugin for key parameters, which included cell area, radius ratio, area box, aspect, and roundness. Using the published spreadsheet template [30], the NII of each cell was calculated with the following formula: NII = Aspect − Area Box + Radius Ratio + Roundness. The area vs. NII of vehicle-treated cells were plotted as a scatter plot using the template, and was considered as the normal cell nuclei. The same plots were generated for each condition, and the NII and area of treated cells were compared to the normal nuclei, and classified as one of the following NMA populations: Normal (N; similar area and NII), Mitotic (S; similar area, slightly higher NII), Irregular (I; similar area, high NII), Small Regular (SR; apoptotic, low area and NII), Senescent (LR; high area, low NII), Small Irregular (SI; low area, high NII), or Large Irregular (LI; high area, high NII). Cells classified as SR exhibited early stages of apoptosis, and cells classified as either I, SI, or LI exhibited significant nuclear damage. The percentage of cells in each NII classification category were calculated and plotted as a histogram using GraphPad Prism. 2.7. ELISA Concentration of secreted ACTH in conditioned media that was collected from organoid cultures was measured using the Human ACTH ELISA Kit (Novus Biologicals, NBP2-66401), according to the manufacturer’s protocol. The enzyme–substrate reaction was measured spectrophotometrically (BioTek Gen5 Micro Plate Reader Version 3.11, Santa Clara, CA, USA) at a wavelength of 450 nm, and the ACTH concentration (pg/mL) was interpolated by a standard curve with a 4-parameter logistic regression analysis, using GraphPad Prism (Version 9.2.0, San Diego, CA, USA). 2.8. Drug Assay Patient adenoma-derived pituitary organoids were grown in 96-well plates and treated with 147 small molecules taken from the NCI AOD9 compound library for 72 h. (https://dtp.cancer.gov/organization/dscb/obtaining/available_plates.html (accessed on 22 August 2021)). Drugs were diluted from 10 mM DMSO stock plates into 100 M DMSO working stocks with a final concentration of 1μM. All vehicle controls were treated with 0.1% DMSO. Organoid proliferation was measured using a CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (MTS, Promega, G3582, Madison, WI, USA) according to the manufacturer’s instruction. Organoid death was calculated based on the absorbance readings at 490 nm, collected from the MTS assay relative to the vehicle controls. Drug screens were performed with biological replicates in the same screen. Drugs were selected based on their ability to target key signaling pathways as well as clinical relevance to the treatment. Drug sensitivity is represented by cell viability, and is significant at <0.5 suppressive effect of the drugs. The percent of cell viability relative to the vehicle control was calculated. Correlation coefficients across each organoid were calculated using the Pearson method to assess confidence in replication. The variance component was detected for each drug across all organoids. A random effect model was run with a single random factor for each drug, and estimated variance was calculated by rejecting the null hypothesis that variation was not present among samples. The drug responses were grouped by variance factor, into large (vc > 100), median (100 > vc > 50), and small (vc < 50). A heatmap was used to display the differential responses in cell viability for the drugs. Drugs that clustered together and showed response within corticotrophs were investigated further based on their mode of action. Pathways (Kegg and Reactome) and gene ontology mapping were conducted for the genes that were being targeted by the drugs, in order to evaluate the key responses in cellular processes. A network was constructed in Cytoscape v 3.8.2 (San Diego, CA, USA) for the purpose of association between the drugs and genes. 2.9. Drug Dose Responses Organoids were grown in Matrigel™ domes within 96-well round-bottom culture plates. Recombinant human SHH was removed from the pituitary organoid growth media, 24 h prior to drug treatment. Organoids were treated with either vehicle (DMSO), cabergoline (Selleckchem S5842), ketoconazole (Selleckchem S1353), roscovitine (Selleckchem S1153), GANT61 (Stemcell Technologies 73692), pasireotide (TargetMol TP2207), mifeprostone (Selleckchem S2606), etomidate (Selleckchem S1329), mitotane (Selleckchem S1732), metyropane (Selleckchem S5416), or osilodrostat (Selleckchem S7456) at concentrations of 0, 1, 10, 100, 1000, and 10,000 nM, for 72 h. The percentage of cell viability was measured using an MTS assay (Promega G3580). Absorbance was measured at 490 nm and normalized to the vehicle. Concentrations were plotted in a logarithmic scale, and a nonlinear dose response curve regression was calculated using GraphPad Prism. An IC50 value for each drug treatment was determined based on the dose response curve, using GraphPad Prism analysis software. 2.10. Calculation of Area under the Curve (AUC) AUC (area under the curve) was determined by plotting the normalized % cell viability versus transformed concentration of the drugs, using a trapezoidal approximation for the area [31]. The formula was based on splitting the curve into trapezoids with bases equal to the % viability (V) and height equal to the interval length (difference in concentrations (C), and then summing the areas of each trapezoid: ∑n0(Vn+Vn−1)2∗(Cn−Cn−1) 2.11. Quantitative RT PCR (qRT-PCR) RNA was collected from patient-derived organoid cultures using the RNeasy Mini Kit (Qiagen). cDNA was generated from the extracted RNA, and then pre-amplified using TaqMan PreAmp Master Mix (Thermo Fisher Scientific 391128). The primers used were human-specific GAPDH (Thermo Fisher Scientific, Applied Biosystems Hs02786624_g1), NR5A1 (SF1) (Thermo Fisher Scientific, Hs00610436_m1), PIT1 (Thermo Fisher Scientific, Hs00230821_m1), TPit (Thermo Fisher Scientific, Hs00193027), and POMC (Thermo Fisher Scientific, Hs01596743_m1). Each PCR reaction was performed using a final volume of 20 µL, composed of 20X TaqMan Expression Assay primers, 2X TaqMan Universal Master Mix (Applied Biosystems, TaqMan® Gene Expression Systems), and a cDNA template. Amplification of each PCR reaction was conducted in a StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), using the following PCR conditions: 2 min at 50 °C, 10 min at 95 °C, denaturing for 15 s at 95 °C, and annealing/extending for 1 min at 60 °C, for a total of 40 cycles. Relative fold change was calculated using the 2 − ∆∆Ct method [32], where CT = threshold cycle. Results were analyzed as the average fold change in gene expression compared to the control, and GAPDH served as an internal control. 2.12. Whole Exome Sequencing WES was performed by the University of Arizona Center for Applied Genetics and Genomic Medicine. Isolated DNA from patient adenoma tissue will be quantified using the Qubit quantitation system with standard curve, as per the supplier protocol (Thermo Fisher Scientific). All samples were further tested for quality using the Fragment Analyzer (Advanced Analytical), following the manufacturer-recommended protocols. Whole exome sequencing (WES) was performed by array capture and approximately 60 Mb of exome target sequence, using the SureSelectXT Human All Exon V6 enrichment (Agilent) or equivalent (which one was used). All exome library builds were quantified via qPCR and subsequently sequenced to a minimum 20X coverage, using paired-end chemistry on the Illumina NovaSeq platform. Whole exome sequencing (WES) was performed by hybridization capture of approx. 35 Mb of the exome target sequence, using the Swift Exome Hyb Panel (Swift Biosciences 83216). All exome library builds were quantified via qPCR and subsequently sequenced to a minimum 20X coverage, using paired-end chemistry on the Illumina NextSeq500 or NovaSeq platform (Illumina). DNA reads were trimmed, filtered by quality scores and aligned to the human genome (hg38) with Burrows–Wheeler Aligner with default parameters. Picard (http://broadinstitute.github.io/picard (accessed on 22 December 2021)) was used to mark duplicates. Germline single nucleotide variants (SNV) were called using the Genome Analysis Tool Kit (GATK), using the given guidelines. Mutations were annotated using ANNOVAR for coding sequences. Variants that passed the quality filter were further investigated for similarity. Concordance between tissue and organoids was calculated using Jaccard similarity index (Jij = Mij/(Mi + Mj − Mij) where Mi is the number of variants in tissues, Mj is the number of variants in organoids, and Mij is the number of identical variants in both tissue and organoid. 2.13. Single Cell RNA Sequencing (scRNA-Seq) Cultures were collected on day 15 of the pituitary directed differentiation schedule, and cells were dissociated into a single-cell suspension using Cell Dissociation Buffer (Thermo Fisher Scientific 13151014). Cells (15,000 cells/sample) were resuspended in the sample buffer (BD Biosciences 65000062), filtered using cell strainer (40 microns), and loaded into a BD Rhapsody cartridge (BD Biosciences 400000847) for single-cell transcriptome isolation. Based on the BD Rhapsody system whole-transcriptome analysis for single-cell whole-transcriptome analysis, microbead-captured single-cell transcriptomes were used to prepare a cDNA library. Briefly, double-stranded cDNA was first generated from the microbead-captured single-cell transcriptome in several steps, including reverse transcription, second-strand synthesis, end preparation, adapter ligation, and whole-transcriptome amplification (WTA). Then, the final cDNA library was generated from double-stranded full-length cDNA by random priming amplification using a BD Rhapsody cDNA Kit (BD Biosciences, 633773), as well as the BD Rhapsody Targeted mRNA and WTA Amplification Kit (BD Biosciences, 633801). The library was sequenced in PE150 mode (paired-end with 150-bp reads) on NovaSeq6000 System (Illumina). A total of 80,000 reads were demultiplexed, trimmed, mapped to the GRCh38 annotation, and quantified using the whole transcriptome analysis pipeline (BD Rhapsody™ WTA Analysis Pipeline v1.10 rev6, San Jose, CA, USA) on the Seven Bridges Genomics platform (https://igor.sbgenomics.com (accessed on 4 April 2022)), prior to clustering analysis in Seurat. For QC and filtration, read counting and unique molecular identifier (UMI) counting were the principal gene expression quantification schemes used in this single-cell RNA-sequencing (scRNA-seq) analysis. The low-quality cells, empty droplets, cell doublets, or multiplets were excluded based on unique feature count (less than 200 or larger than 2500), as they may often exhibit either an aberrantly high gene count or very few genes. Additionally, the mitochondrial QC metrics were calculated, and the cells with >5% mitochondrial counts were filtered out, as the percentage of counts originating from a set of low-quality or dying cells often exhibit extensive mitochondrial contamination. After the removal of unwanted cells from the single cell dataset, the global-scaling normalization method LogNormalize was employed. This method normalizes the feature expression measurements for each cell by the total expression, multiplies this by a scale factor (10,000), and log-transforms the result. The molecules per gene per cell, based on RSEC error correction (RSEC_MolsPerCell file) matrix files from iPSCctrl and iPSCCDH23 samples, were imported into Seurat v4, merged, and processed (as stated above) for UMAP reduction, cluster identification, and differential marker assessment using the FindAllMarkers function within Seurat. 2.14. Statistical Analyses Sample size was based on assessment of power analysis using SigmaStat software. Data collected from each study from at least 4 in vitro technical replicates were analyzed by obtaining the mean ± standard error of the mean (SEM), unless otherwise stated. The significance of the results was then tested using commercially available software (GraphPad Prism, GraphPad software, San Diego, CA, USA). 3. Results 3.1. Generation and Validation of Human PitNET Tissue Derived Organoids Human PitNET tissue was harvested during endoscopic transsphenoidal pituitary surgery from 35 patients in order to generate organoids. These cultures are referred to as human PitNET tissue derived organoids (hPITOs). Supplementary Table S3 summarizes the neuropathology reports and clinical diagnosis from these cases. In summary, 12 corticotroph (functional, CD), and 3 silent corticotroph tumors (nonfunctional tumors), 9 gonadotroph tumors, 8 lactotroph tumors, and 3 somatotroph tumors (acromegaly) were used to generate hPITOs (Supplementary Table S3). Bright-field microscopy images of hPITOs that were generated from corticotroph adenomas from patients diagnosed with CD (Figure 1a–e). Silent/nonfunctioning tumors (Figure 1f,g) revealed morphological diversity among the organoid lines between individual patients and amongst subtypes. Confocal microscopy was used to capture a z-stack through the hPITO38, immunofluorescently stained for CAM5.2 (red), ACTH (green), and Hoechst (nuclear staining, blue) and emphasizes the 3D cellular structure of the hPITOs (Supplemental Video S1). Lactotroph, gonadotroph, and somatotroph adenomas were used to generate hPITOs, and showed the same morphological divergence amongst subtypes and between each patient line (Supplemental Figure S2). Proliferation was measured within the cultures using 5-ethynyl-2′-deoxyuridine (EdU) uptake and showed that the percentage of EdU+ve cells/total Hoechst+ve nuclei directly correlated with the pathology MIB-1 (Ki67) score (red, R2 = 0.9256) (Figure 1a–g, Supplemental Figure S2). ACTH concentration, which was measured by ELISA using organoid conditioned culture media collected from each hPITO line, showed the highest expression in the corticotroph adenoma organoids generated from CD patients (Figure 1h). Figure 1. Morphology and function of corticotroph hPITOs. (a–g) Brightfield images, immunofluorescence staining using antibodies specific for CAM5.2 (red), ACTH (green), and EdU (magenta, inset) of organoid cultures generated from patients with Cushing’s disease (hPITOs 1, 7, 10, 33, 35) or nonfunctional corticotroph adenomas (hPITO8, 12). Quantification of %EdU positive cells/total cell number is shown and compared to the Ki67 score given in the pathology report (Supplemental Table S3). An ELISA was performed using conditioned media collected from (h) corticotroph hPITO cultures and (i) lactotroph, somatotroph, and gonadotroph hPITO cultures for the measurement of ACTH secretion (pg/mL). 3.2. Characterization of Cell Lineages in Pituitary Adenoma-Derived Organoids by Spectral Cytek™ Aurora Analysis In order to validate the similarity in cell lineages identified between the organoid line and the patient’s tumor, we compared the immunohistochemistry from the neuropathology report (Supplemental Table S3) to the expression pattern of pituitary adenoma-specific markers, which were measured using Cytek™ Aurora spectral flow cytometry (Figure 2). The location of cells that are found in each cluster based on the highly expressed antigens are shown in the representative tSNE (viSNE) maps (Figure 2a). Compared to nonfunctional adenoma-derived hPITOs, organoids derived from corticotroph adenomas of CD patients highly expressed proliferating (Ki67+) T-Pit+ ACTH cells (Figure 2a). Interestingly, there was an increase in SOX2+ cells within the total cell population, associated with Crooke’s cell adenoma hPITOs (Figure 2a). Within the total cell population, cell clusters expressing CD45 and vimentin were also measured (Figure 2a). Data for the analysis of corticotroph hPITOs, derived from CD patients and individuals with nonfunctional adenomas, were summarized in a heatmap for each subtype organoid line based on quantified cell abundance (percent of total cells) using spectral flow cytometry (Figure 2b). Figure 2. Cell heterogeneity of corticotroph hPITOs. (a) viSNE maps define spatially distinct cell populations using pituitary specific cell lineage, stem cell, and transcription factor markers. Cell populations were quantified in organoids generated from CD patients with corticotroph adenomas (sparsely granulated and Crooke’s cell adenoma) or patients with nonfunctional corticotroph adenomas. (b) Quantification of the abundance of cells expressing pituitary specific markers as a percent total. viSNE maps define spatially distinct cell populations in organoid cultures generated from CD patient with (c) corticotroph adenoma (hPITO37, Crooke’s cell adenoma) and adjacent normal tissue (hPITO37N), or (d) sparsely granulated corticotroph adenomas (hPITO38) and adjacent normal tissue (hPITO38N). Organoid cultures derived from pituitary adenomas (hPITO37 and hPITO38) were compared to organoids derived from adjacent normal pituitary tissue (hPITO37N and hPITO38N) (Figure 2c,d). While Pit1 lineages including cells expressing GH and PRL, as well as SF1 lineages expressing FSH and LH, were detected in the hPITO37N and hPITO38N organoid cultures, these cell populations were significantly reduced within the patient’s matched adenoma tissue (Figure 2c,d). Overall, hPITOs derived from CD patients expressed increased stem and progenitor cell markers, including CXCR4, SOX2, and CD133 (Figure 2). Collectively, our findings of the characterization of the hPITO cultures support our prediction that this in vitro model recapitulates much of the patient’s adenoma pathophysiology. 3.3. Inherent Patient Differences to Drug Response Is Reflected in the Organoid Culture Tumor recurrence can occur in as many as 30–50% of CD patients after successful surgical treatment [10,33,34]. Unfortunately, bilateral adrenalectomy is the chosen surgical treatment for patients with persistent CD [35]. Bilateral adrenalectomy leads to the increased risk for development of Nelson’s syndrome (progressive hyperpigmentation due to ACTH secretion and expansion of the residual pituitary tumor). Although the risk of developing Nelson’s syndrome following adrenalectomy can be reduced by 50% with stereotactic radiotherapy [35], there is a need to develop medical therapies that directly target the pituitary adenoma. Thus, we established a high-throughput drug screening assay using patient-derived PitNET organoids. After 72 h of treatment, cell viability was measured using an MTS assay, and data were represented as a heatmap whereby blue indicated higher cell death, and red suggested higher cell viability. The replicates behaved consistently with the drug response, with correlation scores of >0.8 for these samples (Figure 3a). We estimated the variance component for each drug across all organoids. Variation among samples was found to be significant (p ≤ 0.05) for each of the 83 drugs. The drug responses were grouped by variance factor into large, median, and small. The larger the variance, the more variable the drug response was across the organoids. We noted a set of drugs that showed a significant differential response across the functional corticotroph organoids. Unsupervised clustering of drug responses across organoids shows a pattern that relates to our statistically calculated results (Figure 3a,c), and the replicates for each independent organoid cluster together. The drugs with higher variance components across all the functional corticotrophs cluster together as a group (Figure 3a). These drugs show cell viability of 10% to 60% across different organoids. Analyzing the pattern more closely, we observe that, within a pathologically defined group, there was a differential organoid response to drugs as well as inherent patient differences to drugs within this group. Figure 3 demonstrates a variation in drug responsiveness amongst the organoid lines generated from individual patients. Importantly, there was further divergence in drug responsiveness amongst the individual organoid lines within each pathologically defined corticotroph subtype. These data clearly demonstrate that the inherent patient difference to drug response which is often observed among CD patients is reflected in the organoid culture. Figure 3. Drug screen using hPITOs generated from CD patients. (a) High-throughput drug screening of hPITOs reveals sensitivities to a range of therapeutic agents. Cell viability with high values (indicating resistance) are depicted in red, and low values (indicating sensitivity) are in blue in the clustered heatmap. (b,c) Clusters showing response to therapeutic agents with the most variance across the organoids. (d) Network of drugs from the clusters b and c and their gene targets, showing their participation in signaling pathways and cellular processes. Drugs that clustered together and showed correlated responses were investigated further for their mode of action based on target genes (Figure 3d). The genes were analyzed for their associations in cellular pathways and gene ontology functional processes. Identified drug–gene pairs were interconnected by cellular pathways that are known to regulate cell cycle, WNT signaling, hedgehog signaling, and neuroactive ligand-receptor interaction signaling pathways (Figure 3d). These identified genes are also known to be influenced by multiple cellular functions, such as cytokine–cytokine receptor interactions and Notch signaling. Proteosome 20S subunit genes PSMAs/PSMBs and the HDAC gene family are involved in many cellular functions. The ephrin receptors (EPHs), adrenoceptor alpha receptors (ADRs), dopamine receptors (DRDs), and the 5-hydroxytryptamine serotonin receptors (HTRs) gene families influence neuronal functions and are targeted by multiple drugs in our focused cluster. These data reveal potential therapeutic pathways for CD patients. Divergent half maximal inhibitory concentration (IC50) values, as documented by an MTS cell viability assay, were observed in response to drug treatment among hPITOs lines 28, 33, 34, 35, and 37. Note that a shift of the curve to the right indicates a higher IC50 (i.e., more resistant to that drug). Cell viability assays were normalized to vehicle-treated controls in order to ensure that toxicity was specific to the drug effects (Figure 4). Dose response curves for organoid 33 and organoid 34 showed better responses at lower doses for cabergoline compared to Metyrapone and osilodrostat, but different for organoid 35, where Metyrapone and osilodrostat gave better responses than Cabergoline (Figure 4a–h). For the drugs mifepristone and GANT61, 33 and 34 had the same level of response to both the drugs. However, when the two organoid responses were compared, 34 had a better response than 33 (Figure 4a–h). Similar divergent drug responses were observed in hPITO lines 37 and 38 (Figure 4i,k). However, organoids generated from adjacent normal pituitary tissue from patients 37 and 38 were nonresponsive to the same standard of care of investigational drugs for CD (Figure 4j,l). These data were consistent with observation made in the drug screen (Figure 3a–c), and demonstrate that there was an inherent difference to drug response within the organoid cultures of the same corticotroph subtype. Figure 4. Drug dose responses by hPITOs generated from CD patients. Dose responses to mifepristone, GANT61, cabergoline, and osilodrostat. (a,e) hPITO28, (b,f) hPITO33, (c,g) hPITO34, and (d,h) hPITO35. Dose responses to cabergoline, ketoconazole, roscovitine, GANT61, pasireotide, mifepristone, etomidate, mitotane, metyrapone, and osilodrostat in (i) hPITO37, (j) organoids generated from adjacent normal pituitary tissue (hPITO37N), (k) hPITO38, (l) hPITO38N, and (m) hPITO39. (n) IC50 and integrated area under the curve in response to mifepristone, ketoconazole, and pasireotide using hPITO39 cultures. Nuclear morphometric analysis of hPITO39 cultures in response to (o,p) vehicle, (q,r) mifepristone, (s,t) pasireotide, and (u,v) ketoconazole. Morphometric classification of NII was based on the normal (N), small (S), small regular (SR), short irregular (SI), large regular (LR), large irregular (LI), and irregular (I) nuclear morphology. Representative Hoechst staining of organoids in response to drug treatments for the calculation of the nuclear irregularity index (NII) are shown in the insets in (p,r,t,v). In addition to cell viability, Nuclear Morphometric Analysis (NMA) using treated organoids was performed based on a published protocol that measures cell viability according to the changes in nuclear morphology of the cells, using nuclear stain Hoechst or DAPI [30]. Nuclear Irregularity Index (NII) was measured based on the quantification of the morphometric changes in the nuclei in response to the standard-of-care drugs mifepristone, pasireotide, and ketoconazole in hPITO39 (Figure 4o–v). The area vs. NII of vehicle-treated cells were plotted as a scatter plot using the template, and considered as the normal cell nuclei (Figure 4o). The same plots were generated for mifepristone (Figure 4q), pasireotide (Figure 4s), and ketoconazole (Figure 4u). The NII and area of treated cells were compared to those of the normal nuclei, and classified as one of the following NMA populations: Normal (N; similar area and NII), Mitotic (S; similar area, slightly higher NII), Irregular (I; similar area, high NII), Small Regular (SR; apoptotic, low area and NII), Senescent (LR; high area, low NII), Small Irregular (SI; low area, high NII), or Large Irregular (LI; high area, high NII) (Figure 4p,r,t,v). Cells classified as SR exhibited early stages of apoptosis, and cells classified as either I, SI, or LI exhibited significant nuclear damage. Data showed that mifepristone induced significant apoptosis in hPITO39 cultures (Figure 4r), compared to responses to pasireotide (Figure 4t) and ketoconazole (Figure 4v). These responses were consistent with the IC50 and the total area under the curve in response to drugs (Figure 4m,n). Measurement of NII is an approach which may be used to confirm potential drug targets identified from the drug screen. 3.4. Organoid Responsiveness to Pasireotide Correlates with SSTR2 and SSTR5 Expression Organoid lines hPITO28, 31, 33, 34, and 35 exhibited divergent IC50 values in response to SSTR agonist pasireotide (Figure 5a). hPITO34 was the most responsive to pasireotide, with a low IC50 value of 6.1 nM (Figure 5a). Organoid lines hPITO33 and hPITO35 were the least responsive, with IC50 values of 1.2 µM and 1 µM, respectively, in response to pasireotide (Figure 5a). The expression of SSTR subtypes 1–5 among the different organoid lines were measured by qRT-PCR and IHC (Figure 5b). One of the least responsive organoid lines, hPITO28, exhibited lower differential expression in SSTR2 and SSTR5 compared to the highly responsive hPITO34 line (Figure 5a,b). Gene expression levels of SSTR2 and SSTR5 within hPITO28 and 34 correlated with protein levels within the patient’s tumor tissue (Figure 5c–f). Given the greater binding affinity for SSTR5 compared to SSTR2 by pasireotide, these data were consistent with greater responsiveness to the drug by hPITO34 in comparison to hPITO28 (Figure 5a,c–f). The expression of SSTR subtypes 2 and 5 within the organoid cultures correlated with the expression patterns of the patient’s tumor tissues (Figure 5a,c–f). Figure 5. SSTR1-5 expression in hPITOs and patient’s PitNET tissue. (a) Dose response of hPITO28, 31, 33, 34, and 35 lines to pasireotide. (b) Differential expression of SSTR subtypes 1–5 (SSTR1, SSTR2, SSTR3, SSTR4, SSTR5) in hPITO28, hPITO31, hPITO33, hPITO34, and hPITO35. Immunohistochemistry of (c,e) SSTR2 and (d,f) SSTR5 expression in patient PitNET tissue (Pt28 and Pt34), from which hPITO28 and 34 were generated. 3.5. Organoids Derived from Pituitary Corticotroph Adenomas Retain the Genetic Alterations of the Patient’s Primary Tumor In order to identify the genetic features of the organoids derived from pituitary adenomas of CD patients, we performed whole-exome sequencing (WES) of hPITOs and the corresponding primary adenoma tissues. We performed WES analysis of each hPITO line, and compared the results with those for the corresponding primary adenoma tissues. We showed the concordance rate of exonic variants between the primary tumor tissues obtained from CD patients and the corresponding organoid line. We identified, on average, approximately 5000 mutations across each of the 14 paired samples of organoids and tissues. For the variants detected, all seven pairs showed a Jaccard index ranging from 0.5 to 0.8. Out of seven pairs, five (hPITO24, 25, 28 and 35) pairs had a Jaccard score of 0.8, while hPITO33 and 34 pairs had 0.7, and hPITO1 had 0.5. In order to investigate the similarity across the SNV (single nucleotide variation) sites, we calculated the Jaccard index of exon sites for synonymous and non-synonymous events, and found scores for all pairs ranging from 0.8 to 0.9. Furthermore, for only non-synonymous events, Jaccard scores also ranged from 0.8 to 0.9, except for hPITO1, which showed overall lower concordance, and had a score of 0.4 to 0.5. Figure 6 shows non-synonymous mutations found in organoid and tissue pairs for some of the key genes that are known to be involved in pituitary adenoma disease. Concordance indices between organoids and the matched patient’s adenoma tissues is reported in Figure 6. Therefore, WES data demonstrated that organoids derived from pituitary corticotroph adenomas retained the genetic alterations of the patient’s primary tumor tissue. Figure 6. Genomic landscape of hPITOs recapitulates genetic alterations commonly found PitNETs. Overview of single nucleotide variation events detected in hPITOs in genes commonly altered in PitNETs. The mutation frequency across the organoid population is depicted on the right. Color coding of the figure shows that organoid lines are derived from the same patient tumor tissue. ORG: organoid line, TIS: matched patient’s PitNET tissue. 3.6. IPSC Pituitary Organoids Generated from a CD Patients Expressing Familial Mutations Reveal Corticotroph Adenoma Pathology In Vitro Extensive research has revealed the role of somatic and germline mutations in the development of CD adenomas [36,37]. Pituitary organoids were developed from iPSCs generated from the PBMCs of CD patients and carrying germline mutations that were identified by WES (Supplemental Figure S4). Chromosomal aberrations were not found when comparing against the reference dataset in the iPSCs generated from the CD patients (Supplemental Figure S3a,b). PBMCs isolated from patients diagnosed with CD were analyzed by WES in order to determine the expression of germline mutations. WES revealed the expression of a more recently identified gene predisposing patients to CD, namely cadherin-related 23 [38] (Supplemental Figure S5). Pituitary organoids were then developed from iPSCs which were generated from the PBMCs of patients with CD (iPSCCDH23 and iPSCMEN1) and a healthy individual (iPSCctrl). Expression of PIT1 (pituitary-specific positive transcription factor 1), ACTH (adrenocorticotropic hormone), GH (growth hormone), FSH (follicle-stimulating hormone), LH (luteinizing hormone), PRL (prolactin), and synaptophysin (synaptophysin) with co-stain Hoechst (nuclei, blue) was measured by immunofluorescence, using chamber slides collected at 15 of the differentiation schedules (Supplemental Figure S6). While pituitary tissue that was differentiated from iPSCctrl expressed all major hormone-producing cell lineages (Supplemental Figure S6a), there was a significant increase in the expression of ACTH and synaptophysin, with a concomitant loss of PIT1, GH, FSH, LH, and PRL in iPSCsMEN1 (Supplemental Figure S6b,c). Interestingly, iPSCCDH23 cultures exhibited a significant increase in the expression of ACTH, GH, LH, and synaptophysin, with a concomitant loss of PIT1, FSH, and PRL (Supplemental Figure S6b,c). Immunofluorescence of iPSCs collected on the fourth day of the differentiation schedule revealed no expression of PIT1, ACTH, GH, FSH, LH, or PRL in (data not shown). Compared to control lines, iPSC lines expressing mutated CDH23 secreted significantly greater concentrations of ACTH earlier in the differentiation schedule (Supplemental Figure S7a). The upregulated expression of pituitary corticotroph adenoma-specific markers in iPSCCDH23 and iPSCMEN1 demonstrates that the iPSC-derived organoids represented the pathology of corticotroph adenomas in vitro. 3.7. ScRNA-seq Reveals the Existence of Unique Proliferative Cell Populations in iPSCCDH23 Cultures When Compared to iPSCsctrl Using Seurat to identify cell clusters, as well as Uniform Manifold Approximation and Projection 9UMAP, clustering analysis identified 16 distinct cell populations/clusters consisting of known marker genes. Clusters 1, 5, and 7 of the iPSCsCDH23 were distinct from the iPSCctrl cultures (Figure 7a,b). Pituitary stem cells were characterized in iPSCctrl and iPSCCDH23 cultures (Figure 7b). Clusters 1 and 5 expressed markers consistent with the corticotroph subtype cell lineage (Figure 5c). Markers of dysregulated cell cycles and increased proliferation were identified in cell cluster 7 (Figure 7c). Expression of the E2 factor (E2F) family of transcription factors, which are downstream effectors of the retinoblastoma (RB) protein pathway and play a crucial role in cell division control, were identified in distinct cell cluster 7, which was identified within the iPSCCDH23 cultures (Figure 7c). Stem cell markers were also upregulated in cell cluster 7, and identified within the iPSCCDH23 cultures (Figure 7c). Using Cytobank software to analyze organoids collected 30 days post-differentiation, cells were gated on live CK20 positive singlets, and 9000 events per sample were analyzed by the viSNE algorithm. ViSNE plots are shown in two dimensions with axes identified by tSNE- 1 and tSNE-2, and each dot representing a single cell positioned in the multidimensional space (Figure 7d). Individual flow cytometry standard files were concatenated into single flow cytometry standard files, from which 12 spatially distinct populations were identified (Figure 7e). Overlaying cell populations identified by traditional gating strategies onto viSNE plots identified unique cell populations within the iPSCCDH23 cultures (Figure 7e). There were distinct cell populations between the iPSCctrl and iPSCCDH23 organoids, in addition to expression of hormone and cell lineage markers such as ACTH, TPit, PRL, and PIT1 (Figure 7e). The cell populations that exhibited high expression of Ki67 within the iPSCctrl organoid cultures included SOX2+ and PIT1+ populations (Figure 7f). The highly proliferating cell populations within the iPSCCDH23 organoid cultures included those that expressed CD90+/VIM+/CXCR4+ (mesenchymal stem cells), CXCR4+/SOX2+ (stem cells), TPit+ (corticotroph cell lineage), CD133+/CD31+ (endothelial progenitor cells), and CK20+/VIM+/CXCR4+ (hybrid epithelial-mesenchymal stem cells) (Figure 7f). Overall, the iPSCCDH23 organoids were significantly more proliferative compared to the iPSCctrl cultures (Figure 7f). Immunofluorescence staining of iPSCCDH23 organoids revealed increased mRNA expression of TPit and POMC, which correlated with increased ACTH protein compared to iPSCsctrl (Supplemental Figure S6). As shown in Supplemental Figure S6b,c, iPSCCDH23 cultures also exhibited a significant increase in the expression of GH and LH (Supplemental Figure S6b,c). Figure 7. Single cell analysis of iPSCctrl and iPSCCDH23 cultures 15 and 30 days post-directed differentiation. (a) UMAP plots showing identified cell clusters 0–16 in iPSCctrl and iPSCCDH23 cultures 15 days post-directed differentiation. (b) Violin plots of representative identified markers of the corticotroph cell lineage, where 2 subpopulations were observed among iPSCctrl and iPSCCDH23 cultures. Arrows highlight clusters 1, 5, and 7. (c) Violin plots showing expression of genes representative of stem cells, Wnt, NOTCH, Hh and SST signaling, anterior pituitary (corticotroph) cell lineage, and cell cycle in clusters 1, 5, and 7 of iPSCCDH23 cultures. Plot width: cell number, plot height: gene expression. (d) viSNE maps showing concatenated flow cytometry standard files for both samples and iPSCctrl and iPSCCDH23 organoids 30 days post-directed differentiation. (e) Overlay of manually gated cell populations onto viSNE plots. (f) Fluorescent intensity of Ki67 of viSNE maps for both samples and iPSCctrl and iPSCCDH23 organoids. iPSCctrl = 22518 events; iPSCCDH23 = 17542 events. Collectively, Figure 7 demonstrates that the development of pituitary organoids generated from iPSCs of CD patients may reveal the existence of cell populations which, potentially, contribute to the support of adenoma growth and progression, as well as an expansion of stem and progenitor cells that may be the targets for tumor recurrence. 4. Discussion Our studies demonstrate the development of organoids generated from human PitNETs (hPITOs) can potentially be used to screen for the sensitivity and efficacy of responses to targeted therapies for CD patients that either fail to achieve remission or exhibit recurrence of disease after surgery. In addition, we have documented that induced pluripotent stem cells (iPSCs) generated from a CD patient expressing germline mutation CDH23 (iPSCCDH23) reveals the disease pathogenesis under directed differentiation. Many early in vitro experiments have used pituitary cell lines, spheroids, aggregates, and/or tumoroids that do not replicate the primary PitNET microenvironment [19,20,21], and lack a multicellular identity [39,40]. The development of PitNET tissue-generated organoids is limited to the use of transgenic mouse models as the source [22,23,41]. The recent organoid cultures reported by Nys et al. [42] have been generated from single stem cells isolated from PitNET tissue, and are claimed to be true organoids due to their clonality. However, multicellular complexity was not validated by the protein expression or hormone secretion from pituitary cell lineages in these cultures [42]. According to the National Cancer Institute (NCI, NIH), an ‘organoid’ is defined as “a tiny, 3-dimensional mass of tissue that is made by growing stem cells (cells from which other types of cells develop) in the laboratory” [43]. The hPITOs reported here begin from single and/or 3–4 cell clusters dissociated from the PitNET tissue that harbors the stem cells. Supplemental Video S2 demonstrates a process of ‘budding,’ as well as lumen formation as organoids grow and differentiate. We document differentiation and function by comprehensive spectral flow cytometry, ELISA, and response to standard of care drugs. The growth of PitNET organoids reported in the current study is consistent with that of gastrointestinal tissue derived cultures that begin from cell clusters, crypts, or glands [27,44,45]. Our studies report a PitNET tissue organoid culture with a multicellular identity consisting of differentiated cell lineages, stem/progenitor cells, and immune and stromal cell compartments, which replicates much of the patient’s own adenoma pathology, functionality, and complexity. We have also demonstrated that iPSCs, derived from the blood of a CD patient, can be directly differentiated into pituitary organoids that resemble similar characteristics to the tumor tissue. Many investigators have proposed the use of organoids in personalized medicine, but have focused these efforts on targeted treatment of cancers [27,46,47,48]. The findings reported in these studies are the first to implement this approach for the potential treatment of PitNETs. Collectively, we have developed a relevant human in vitro approach to potentially advance our knowledge as well as our approach to studies in the field of pituitary tumor research. Both the hPITOs and the iPSCCDH23 may be implemented in studies that strive to (1) define the molecular and cellular events that are crucial for the development of PitNETs leading to CD, and (2) accelerate the identification of effective targeted therapies for patients with CD. While published studies have advanced our understanding of the molecular mechanisms of the pathogenesis of corticotroph adenomas and elucidated candidate therapeutic targets for CD, these reports fall short of directly informing clinical decisions for patient treatment. Using organoids to screen potential drugs and compounds can potentially improve therapeutic accuracy. Figure 3 demonstrated a variation in drug responsiveness amongst the organoid lines generated from individual patients. Importantly, there was further divergence in drug responsiveness amongst the individual organoid lines within each pathologically defined corticotroph subtype. For example, hPITOs generated from patients with sparsely granulated corticotroph adenomas (hPIT0s 10, 25, 34, 35) and Crooke’s cell adenomas (hPITOs 7, 33) showed variable responses regardless of similar pathologically defined subtypes. In addition, the response of the tumor cells within the organoids to the standard of care drugs that directly target the pituitary in the body, including mifepristone and cabergoline, was only 50% in hPITO34 and hPITO35, and almost 0% in the other lines, including hPITO7, 10, and 25. These data clearly demonstrate that the inherent patient difference to drug response that is often observed among CD patients is reflected in the organoid culture. This culture system may be an approach that will provide functional data revealing actionable treatment options for each patient. Patient-derived organoids from several tumors have served as a platform for testing the efficacy of anticancer drugs and predicting responses to targeted therapies in individual patients [27,46,48,49,50]. An example of the use of organoids in identifying drug responsiveness within an endocrine gland is that of papillary thyroid cancer [51]. Organoids developed from PTC patients were used as a preclinical model for studying responsiveness to anticancer drugs in a personalized approach [51]. However, our study is the first report of the use of hPITOs for drug screening. Connecting genetic and drug sensitivity data will further categorize corticotroph subtypes associated with CD. WES analysis of each hPITO line was compared to the results for the corresponding primary adenoma tissues. We showed the concordance rate of exonic variants between the primary tumor tissues obtained from CD patients and the corresponding organoid line. On average, approximately 80% of the variants observed in the CD patients’ adenoma tissues were retained in the corresponding hPITOs. Pituitary organoids were also developed from iPSCs generated from PBMCs of a CD patient expressing a germline genetic alteration in cadherin-related 23 CDH23 (iPSCCDH23), a CD patient expressing an MEN1 mutation (iPSCMEN1), and a healthy individual (iPSCctrl). Foundational studies performed by investigators at the genome level have revealed significant knowledge regarding the pathophysiology of CD [36,37,52,53]. In some instances, CD is a manifestation of genetic mutation syndromes that include multiple endocrine neoplasia type 1 (MEN1), familial isolated pituitary adenoma (FIPA), and Carney complex [54,55]. CDH23 syndrome is clinically associated with the development of Usher syndrome, deafness, and vestibular dysfunction [56]. Several mutations in CDH23 are associated with inherited hearing loss and blindness [57]. However, none of the variants found in this study were linked to any symptoms of deafness or blindness. A possible explanation is that deafness-related CDH23 mutations are caused by either homozygous or compound heterozygous mutations [57]. In a study that linked mutations in CDH23 with familial and sporadic pituitary adenomas, it was suggested that these genetic alterations could play important roles in the pathogenesis of CD [38]. Genomic screening in a total of 12 families with familial PitNETs, 125 individuals with sporadic pituitary tumors, and 260 control individuals showed that 33% of the families with familial pituitary tumors and 12% of individuals with sporadic pituitary tumors expressed functional or pathogenic CDH23 variants [38]. Consistent with the expected pathology and function of a PitNET from a patient with CD, iPSCCDH23 organoids exhibited hypersecretion of ACTH, and expression of transcription factors and cell markers were reported in the pathology report for corticotroph PitNETs. Collectively, these findings warrant further investigation to determine whether carriers of CDH23 mutations are at a high risk of developing CD and/or hearing loss. Specifically, clinical investigation is required to determine whether pituitary MRI scans should be adopted in the screening of CDH23-related diseases, including Usher syndrome and age-related hearing loss. Pituitary organoids generated from iPSCs of a CD patient revealed the existence of cell populations that potentially contribute to the support of PitNET growth and disease progression, as well as an expansion of stem and progenitor cells that may be the targets for tumor recurrence. Organoids derived from both pituitary adenomas and iPSCs exhibited increased expression of stem cell and progenitor markers at both the protein and transcriptomic levels. Unique clusters that were proliferative in the iPSCCDH23 organoids expressed a hybrid pituitary cell population which was in an epithelial/mesenchymal state (CK20+/VIM+/CXCR4+/Ki67+). In support of our findings, a similar report of a hybrid epithelial/mesenchymal pituitary cell has been made as part of the normal developmental stages of the human fetal pituitary [58]. Previous studies have suggested that pituitary stem cells undergo an EMT-like process during cell migration and differentiation [59,60,61]. Consistent with our findings are extensive studies using single cells isolated from human pituitary adenomas to show increased expression of stem cell markers SOX2 and CXCR4 [22,23,41,62,63]. Within the clusters identified in the iPSCCDH23 culture were cell populations expressing stem cell markers, including SOX2, NESTIN, CXCR4, KLF4, and CD34. The same iPSCCDH23 cell clusters, 4, 8, 9, and 11, co-expressed upregulated genes of NOTCH, Hedgehog, WNT, and TGFβ signaling, which are pivotal not only in pituitary tumorigenesis and pituitary embryonic development, but also in ‘tumor stemness’ [22,23,41,62,63,64]. We also noted that clusters of cell populations 5 and 14 unique within the iPSCCDH23 cultures expressed upregulated genes which were indicative of high proliferation. We observed upregulated expression of the E2F family of transcription factors (E2Fs) E2F1 and E2F7. These findings are of significance, given that there is evidence to show that upregulation of E2Fs is fundamental for tumorigenesis, metastasis, drug resistance, and recurrence [65]. Within the pituitary adenoma microenvironment, whether these stem cells directly differentiate into pituitary tumors or support the growth of the adenoma is largely unknown. In addition, whether pituitary stem cell populations become activated in response to injury is also understudied. Although the role of stem cells has been identified using a mouse model through implantation of the cells within the right forebrain [66], the identification of pituitary tumor-initiating stem cells using in vivo orthotopic transplantation models is impossible in mice. Pituitary tumors harboring the stem cells may require engraftment within the environment from which the cells are derived in order to enable growth and differentiation of the tumor. However, it is technically impossible to implant cells orthotopically in the murine pituitary. The pituitary tumor organoid cultures presented in these studies may offer an approach by which isolation, identification, and characterization of this stem cell population is possible. Therefore, we would gain knowledge on the mechanisms of pituitary tumor pathogenesis and reveal potential novel targets for therapeutic interventions by using the iPSC generated pituitary organoid culture. PitNETs associated with the development of CD cause serious morbidity due to chronic cortisol exposure that dysregulates almost every organ system in the body. Overall, existing medical therapies remain suboptimal, with negative impact on health and quality of life, including considerable risk of therapy resistance and tumor recurrence. To date, little is known about the pathogenesis of PitNETs. Here, we present a human organoid-based approach that will allow us to acquire knowledge of the mechanisms underlying pituitary tumorigenesis. Such an approach is essential to identify targeted treatments and improve clinical management of patients with CD. 5. Conclusions Cushing’s disease (CD) is a serious endocrine disorder caused by an adrenocorticotropic hormone (ACTH)-secreting pituitary neuroendocrine tumor (PitNET), which stimulates the adrenal glands to overproduce cortisol. The absence of preclinical models that replicate the PitNET microenvironment has prevented us from acquiring the knowledge to identify therapies that can be targeted to the tumor with a higher efficacy and tolerability for patients. Our studies demonstrate the development of organoids generated from human PitNETs or induced pluripotent stem cells as an essential approach to identifying targeted therapy methods for CD patients. Supplementary Materials The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells11213344/s1, Figure S1: Antibodies used and Cytek® Full Spectrum Viewer showing calculated similarity indices; Figure S2: Morphology and proliferation of lactotroph, somatotroph, and gonadotroph hPITOs; Table S1: Pituitary Growth Media; Table S2: Components used for pituitary organoids generated from iPSCs; Table S3: clinical characteristics of pituitary adenoma samples used for the generation of organoids; Table S4: Average correlation of replicates reported in Figure 3; Table S5: pituitary cell lineage or stem cell markers used in the scRNA-seq analysis; Video S1: hPITO38 EdU ACTH 3. Author Contributions Conceptualization, Y.Z.; methodology, J.C., Y.Z., J.M.C., B.N.S., S.M. and K.W.P.; software, J.C., Y.Z., J.M.C., S.M., Y.C., P.M. and R.P.; validation, Y.Z., J.C., J.M.C., A.S.L., K.C.J.Y. and R.P.; formal analysis, J.C., Y.Z., J.M.C., R.P., Y.C., S.M. and P.M.; investigation, Y.Z.; resources, Y.Z., J.C., J.E., C.A.T., B.H. and A.S.L.; data curation, J.C., Y.Z., J.M.C., R.P. and S.M.; writing—original draft preparation, Y.Z., J.C, S.M., J.M.C., Y.C., B.H. and R.P.; writing—review and editing, Y.Z., J.C., J.M.C., A.S.L., K.C.J.Y., S.M., J.E., C.A.T., K.W.P., B.H., Y.C., P.M., B.N.S. and R.P.; visualization, Y.Z., J.C., J.M.C., A.S.L., K.C.J.Y. and R.P.; supervision, Y.Z.; project administration, Y.Z.; funding acquisition, Y.Z. All authors have read and agreed to the published version of the manuscript. Funding This research was supported by the Department of Cellular and Molecular Medicine (University of Arizona College of Medicine) startup funds (Zavros). This research study was also partly supported by the National Cancer Institute of the National Institutes of Health under award number P30 CA023074 (Sweasy). Institutional Review Board Statement The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Board of St. Joseph’s Hospital and Barrow Neurological Institute Biobank collection protocol PHXA-05TS038, and collection of outcomes data protocol PHXA-0004-72-29, and patient consent (protocol date of approval). Informed Consent Statement Written informed consent was obtained from all subjects involved in the study. Data Availability Statement The datasets generated during the analysis of the present study are available in the ReDATA repository, https://doi.org/10.25422/azu.data.19755244.v1. The datasets generated in the current study are also available from the corresponding author on reasonable request. All data generated or analyzed during this study are included in this published article (and its Supplementary Information Files). Acknowledgments We acknowledge the technical support of Maga Sanchez in the Tissue Acquisition and Cellular/Molecular Analysis Shared Resource (TACMASR University of Arizona Cancer Center) for assistance with embedding and sectioning of organoids. We would also like to acknowledge Patty Jansma (Marley Imaging Core, University Arizona) and, Douglas W Cromey (TACMASR imaging, University of Arizona Cancer Center) for assistance in microscopy. The authors thank the patients who consented to donate pituitary tumor tissues and blood for the development of the organoids. Without their willingness to participate in the study, this work would not be possible. Conflicts of Interest The authors declare no conflict of interest. References Cushing, H. Posterior Pituitary Activity from an Anatomical Standpoint. Am. J. Pathol. 1933, 9, 539–548.19. [Google Scholar] [PubMed] Cushing, H. The basophil adenomas of the pituitary body and their clinical manifestations (pituitary basophilism) 1932. Obes. Res. 1994, 2, 486–508. [Google Scholar] [CrossRef] [PubMed] Ironside, N.; Chen, C.J.; Lee, C.C.; Trifiletti, D.M.; Vance, M.L.; Sheehan, J.P. Outcomes of Pituitary Radiation for Cushing’s Disease. Endocrinol. Metab. Clin. N. Am. 2018, 47, 349–365. [Google Scholar] [CrossRef] Loriaux, D.L. Diagnosis and Differential Diagnosis of Cushing’s Syndrome. N. Engl. J. Med. 2017, 377, e3. [Google Scholar] [CrossRef] Asa, S.L.; Mete, O.; Perry, A.; Osamura, R.Y. Overview of the 2022 WHO Classification of Pituitary Tumors. Endocr. Pathol. 2022, 33, 6–26. [Google Scholar] [CrossRef] Nishioka, H.; Yamada, S. Cushing’s Disease. J. Clin. Med. 2019, 8, 1951. [Google Scholar] [CrossRef] [PubMed] Feelders, R.A.; Hofland, L.J. Medical treatment of Cushing’s disease. J. Clin. Endocrinol. Metab. 2013, 98, 425–438. [Google Scholar] [CrossRef] Limumpornpetch, P.; Morgan, A.W.; Tiganescu, A.; Baxter, P.D.; Nyawira Nyaga, V.; Pujades-Rodriguez, M.; Stewart, P.M. The Effect of Endogenous Cushing Syndrome on All-cause and Cause-specific Mortality. J. Clin. Endocrinol. Metab. 2022, 107, 2377–2388. [Google Scholar] [CrossRef] Ciric, I.; Zhao, J.C.; Du, H.; Findling, J.W.; Molitch, M.E.; Weiss, R.E.; Refetoff, S.; Kerr, W.D.; Meyer, J. Transsphenoidal surgery for Cushing disease: Experience with 136 patients. Neurosurgery 2012, 70, 70–80; discussion 71–80. [Google Scholar] [CrossRef] Alexandraki, K.I.; Kaltsas, G.A.; Isidori, A.M.; Storr, H.L.; Afshar, F.; Sabin, I.; Akker, S.A.; Chew, S.L.; Drake, W.M.; Monson, J.P.; et al. Long-term remission and recurrence rates in Cushing’s disease: Predictive factors in a single-centre study. Eur. J. Endocrinol. 2013, 168, 639–648. [Google Scholar] [CrossRef] Sonino, N.; Zielezny, M.; Fava, G.A.; Fallo, F.; Boscaro, M. Risk factors and long-term outcome in pituitary-dependent Cushing’s disease. J. Clin. Endocrinol. Metab. 1996, 81, 2647–2652. [Google Scholar] [CrossRef] [PubMed] Van der Pas, R.; Feelders, R.A.; Gatto, F.; De Bruin, C.; Pereira, A.M.; Van Koetsveld, P.M.; Sprij-Mooij, D.M.; Waaijers, A.M.; Dogan, F.; Schulz, S.; et al. Preoperative normalization of cortisol levels in Cushing’s disease after medical treatment: Consequences for somatostatin and dopamine receptor subtype expression and in vitro response to somatostatin analogs and dopamine agonists. J. Clin. Endocrinol. Metab. 2013, 98, E1880–E1890. [Google Scholar] [CrossRef] Kondziolka, D. Cushing’s disease and stereotactic radiosurgery. J. Neurosurg. 2013, 119, 1484–1485; discussion 1485. [Google Scholar] [CrossRef] [PubMed] Mehta, G.U.; Sheehan, J.P.; Vance, M.L. Effect of stereotactic radiosurgery before bilateral adrenalectomy for Cushing’s disease on the incidence of Nelson’s syndrome. J. Neurosurg. 2013, 119, 1493–1497. [Google Scholar] [CrossRef] [PubMed] Tritos, N.A. Adrenally Directed Medical Therapies for Cushing Syndrome. J. Clin. Endocrinol. Metab. 2021, 106, 16–25. [Google Scholar] [CrossRef] [PubMed] Gheorghiu, M.L.; Negreanu, F.; Fleseriu, M. Updates in the Medical Treatment of Pituitary Adenomas. Horm. Metab. Res. 2020, 52, 8–24. [Google Scholar] [CrossRef] Kaiser, U.B. Cushing’s disease: Towards precision medicine. Cell. Res. 2015, 25, 649–650. [Google Scholar] [CrossRef] Bissell, M.S.a.M.J. Organoids: A historical perspective of thinking in three dimensions. J. Cell Biol. 2017, 216, 31–40. [Google Scholar] [CrossRef] Danila, D.C.; Zhang, X.; Zhou, Y.; Dickersin, G.R.; Fletcher, J.A.; Hedley-Whyte, E.T.; Selig, M.K.; Johnson, S.R.; Klibanski, A. A human pituitary tumor-derived folliculostellate cell line. J. Clin. Endocrinol. Metab. 2000, 85, 1180–1187. [Google Scholar] [CrossRef] Bjoro, T.; Torjesen, P.A.; Ostberg, B.C.; Sand, O.; Iversen, J.G.; Gautvik, K.M.; Haug, E. Bombesin stimulates prolactin secretion from cultured rat pituitary tumour cells (GH4C1) via activation of phospholipase C. Regul. Pept. 1987, 19, 169–182. [Google Scholar] [CrossRef] Bjoro, T.; Sand, O.; Ostberg, B.C.; Gordeladze, J.O.; Torjesen, P.; Gautvik, K.M.; Haug, E. The mechanisms by which vasoactive intestinal peptide (VIP) and thyrotropin releasing hormone (TRH) stimulate prolactin release from pituitary cells. Biosci. Rep. 1990, 10, 189–199. [Google Scholar] [CrossRef] [PubMed] Cox, B.; Laporte, E.; Vennekens, A.; Kobayashi, H.; Nys, C.; Van Zundert, I.; Uji, I.H.; Vercauteren Drubbel, A.; Beck, B.; Roose, H.; et al. Organoids from pituitary as a novel research model toward pituitary stem cell exploration. J. Endocrinol. 2019, 240, 287–308. [Google Scholar] [CrossRef] [PubMed] Vennekens, A.; Laporte, E.; Hermans, F.; Cox, B.; Modave, E.; Janiszewski, A.; Nys, C.; Kobayashi, H.; Malengier-Devlies, B.; Chappell, J.; et al. Interleukin-6 is an activator of pituitary stem cells upon local damage, a competence quenched in the aging gland. Proc. Natl. Acad. Sci. USA 2021, 118, e2100052118. [Google Scholar] [CrossRef] [PubMed] Zhang, D.; Hugo, W.; Redublo, P.; Miao, H.; Bergsneider, M.; Wang, M.B.; Kim, W.; Yong, W.H.; Heaney, A.P. A human ACTH-secreting corticotroph tumoroid model: Novel Human ACTH-Secreting Tumor Cell in vitro Model. EBioMedicine 2021, 66, 103294. [Google Scholar] [CrossRef] [PubMed] Tsukada, T.; Kouki, T.; Fujiwara, K.; Ramadhani, D.; Horiguchi, K.; Kikuchi, M.; Yashiro, T. Reassembly of anterior pituitary organization by hanging drop three-dimensional cell culture. Acta. Histochem. Cytochem. 2013, 46, 121–127. [Google Scholar] [CrossRef] [PubMed] Narsinh, K.H.; Jia, F.; Robbins, R.C.; Kay, M.A.; Longaker, M.T.; Wu, J.C. Generation of adult human induced pluripotent stem cells using nonviral minicircle DNA vectors. Nat. Protoc. 2011, 6, 78–88. [Google Scholar] [CrossRef] Steele, N.G.; Chakrabarti, J.; Wang, J.; Biesiada, J.; Holokai, L.; Chang, J.; Nowacki, L.M.; Hawkins, J.; Mahe, M.; Sundaram, N.; et al. An Organoid-Based Preclinical Model of Human Gastric Cancer. Cell. Mol. Gastroenterol. Hepatol. 2019, 7, 161–184. [Google Scholar] [CrossRef] Bertaux-Skeirik, N.; Feng, R.; Schumacher, M.A.; Li, J.; Mahe, M.M.; Engevik, A.C.; Javier, J.E.; Peek, R.M.J.; Ottemann, K.; Orian-Rousseau, V.; et al. CD44 plays a functional role in Helicobacter pylori-induced epithelial cell proliferation. PLoS Pathog. 2015, 11, e1004663. [Google Scholar] [CrossRef] Feng, R.; Aihara, E.; Kenny, S.; Yang, L.; Li, J.; Varro, A.; Montrose, M.H.; Shroyer, N.F.; Wang, T.C.; Shivdasani, R.A.; et al. Indian Hedgehog mediates gastrin-induced proliferation in stomach of adult mice. Gastroenterology 2014, 147, 655–666.e9. [Google Scholar] [CrossRef] Filippi-Chiela, E.C.; Oliveira, M.M.; Jurkovski, B.; Callegari-Jacques, S.M.; da Silva, V.D.; Lenz, G. Nuclear morphometric analysis (NMA): Screening of senescence, apoptosis and nuclear irregularities. PLoS ONE 2012, 7, e42522. [Google Scholar] [CrossRef] Gagnon, R.C.; Peterson, J.J. Estimation of confidence intervals for area under the curve from destructively obtained pharmacokinetic data. J. Pharm. Biopharm. 1998, 26, 87–102. [Google Scholar] [CrossRef] [PubMed] Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed] Hinojosa-Amaya, J.M.; Varlamov, E.V.; McCartney, S.; Fleseriu, M. Hypercortisolemia Recurrence in Cushing’s Disease; a Diagnostic Challenge. Front. Endocrinol. 2019, 10, 740. [Google Scholar] [CrossRef] [PubMed] Patil, C.G.; Prevedello, D.M.; Lad, S.P.; Vance, M.L.; Thorner, M.O.; Katznelson, L.; Laws, E.R., Jr. Late recurrences of Cushing’s disease after initial successful transsphenoidal surgery. J. Clin. Endocrinol. Metab. 2008, 93, 358–362. [Google Scholar] [CrossRef] Katznelson, L. Bilateral adrenalectomy for Cushing’s disease. Pituitary 2015, 18, 269–273. [Google Scholar] [CrossRef] Reincke, M.; Sbiera, S.; Hayakawa, A.; Theodoropoulou, M.; Osswald, A.; Beuschlein, F.; Meitinger, T.; Mizuno-Yamasaki, E.; Kawaguchi, K.; Saeki, Y.; et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat. Genet. 2015, 47, 31–38. [Google Scholar] [CrossRef] Chen, J.; Jian, X.; Deng, S.; Ma, Z.; Shou, X.; Shen, Y.; Zhang, Q.; Song, Z.; Li, Z.; Peng, H.; et al. Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat. Commun. 2018, 9, 3171. [Google Scholar] [CrossRef] Zhang, Q.; Peng, C.; Song, J.; Zhang, Y.; Chen, J.; Song, Z.; Shou, X.; Ma, Z.; Peng, H.; Jian, X.; et al. Germline Mutations in CDH23, Encoding Cadherin-Related 23, Are Associated with Both Familial and Sporadic Pituitary Adenomas. Am. J. Hum. Genet. 2017, 100, 817–823. [Google Scholar] [CrossRef] Ikeda, H.; Mitsuhashi, T.; Kubota, K.; Kuzuya, N.; Uchimura, H. Epidermal growth factor stimulates growth hormone secretion from superfused rat adenohypophyseal fragments. Endocrinology 1984, 115, 556–558. [Google Scholar] [CrossRef] Baek, N.; Seo, O.W.; Kim, M.; Hulme, J.; An, S.S. Monitoring the effects of doxorubicin on 3D-spheroid tumor cells in real-time. Onco. Targets 2016, 9, 7207–7218. [Google Scholar] [CrossRef] Laporte, E.; Nys, C.; Vankelecom, H. Development of Organoids from Mouse Pituitary as In Vitro Model to Explore Pituitary Stem Cell Biology. J. Vis. Exp. 2022. [Google Scholar] [CrossRef] [PubMed] Nys, C.; Lee, Y.L.; Roose, H.; Mertens, F.; De Pauw, E.; Kobayashi, H.; Sciot, R.; Bex, M.; Versyck, G.; De Vleeschouwer, S.; et al. Exploring stem cell biology in pituitary tumors and derived organoids. Endocr. Relat. Cancer 2022, 29, 427–450. [Google Scholar] [CrossRef] Available online: https://www.cancer.gov/publications/dictionaries/cancer-terms/def/organoid (accessed on 20 September 2022). Mahe, M.M.; Aihara, E.; Schumacher, M.A.; Zavros, Y.; Montrose, M.H.; Helmrath, M.A.; Sato, T.; Shroyer, N.F. Establishment of Gastrointestinal Epithelial Organoids. Curr. Protoc. Mouse Biol. 2013, 3, 217–240. [Google Scholar] [CrossRef] [PubMed] Schumacher, M.A.; Aihara, E.; Feng, R.; Engevik, A.; Shroyer, N.F.; Ottemann, K.M.; Worrell, R.T.; Montrose, M.H.; Shivdasani, R.A.; Zavros, Y. The use of murine-derived fundic organoids in studies of gastric physiology. J. Physiol. 2015, 593, 1809–1827. [Google Scholar] [CrossRef] [PubMed] Holokai, L.; Chakrabarti, J.; Lundy, J.; Croagh, D.; Adhikary, P.; Richards, S.S.; Woodson, C.; Steele, N.; Kuester, R.; Scott, A.; et al. Murine- and Human-Derived Autologous Organoid/Immune Cell Co-Cultures as Pre-Clinical Models of Pancreatic Ductal Adenocarcinoma. Cancers 2020, 12, 3816. [Google Scholar] [CrossRef] [PubMed] Boj, S.F.; Hwang, C.I.; Baker, L.A.; Chio, I.I.C.; Engle, D.D.; Corbo, V.; Jager, M.; Ponz-Sarvise, M.; Tiriac, H.; Spector, M.S.; et al. Organoid models of human and mouse ductal pancreatic cancer. Cell 2015, 160, 324–338. [Google Scholar] [CrossRef] Tiriac, H.; Belleau, P.; Engle, D.D.; Plenker, D.; Deschenes, A.; Somerville, T.D.D.; Froeling, F.E.M.; Burkhart, R.A.; Denroche, R.E.; Jang, G.H.; et al. Organoid Profiling Identifies Common Responders to Chemotherapy in Pancreatic Cancer. Cancer Discov. 2018, 8, 1112–1129. [Google Scholar] [CrossRef] Driehuis, E.; van Hoeck, A.; Moore, K.; Kolders, S.; Francies, H.E.; Gulersonmez, M.C.; Stigter, E.C.A.; Burgering, B.; Geurts, V.; Gracanin, A.; et al. Pancreatic cancer organoids recapitulate disease and allow personalized drug screening. Proc. Natl. Acad. Sci. USA 2019 116, 26580–26590. [CrossRef] Jung, Y.H.; Choi, D.H.; Park, K.; Lee, S.B.; Kim, J.; Kim, H.; Jeong, H.W.; Yang, J.H.; Kim, J.A.; Chung, S.; et al. Drug screening by uniform patient derived colorectal cancer hydro-organoids. Biomaterials 2021, 276, 121004. [Google Scholar] [CrossRef] Chen, D.; Tan, Y.; Li, Z.; Li, W.; Yu, L.; Chen, W.; Liu, Y.; Liu, L.; Guo, L.; Huang, W.; et al. Organoid Cultures Derived From Patients With Papillary Thyroid Cancer. J. Clin. Endocrinol. Metab. 2021, 106, 1410–1426. [Google Scholar] [CrossRef] Reincke, M.; Theodoropoulou, M. Genomics in Cushing’s Disease: The Dawn of a New Era. J. Clin. Endocrinol. Metab. 2021, 106, e2455–e2456. [Google Scholar] [CrossRef] [PubMed] Ma, Z.Y.; Song, Z.J.; Chen, J.H.; Wang, Y.F.; Li, S.Q.; Zhou, L.F.; Mao, Y.; Li, Y.M.; Hu, R.G.; Zhang, Z.Y.; et al. Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell. Res. 2015, 25, 306–317. [Google Scholar] [CrossRef] [PubMed] Melmed, S. Pathogenesis of pituitary tumors. Nat. Rev. Endocrinol. 2011, 7, 257–266. [Google Scholar] [CrossRef] [PubMed] Stratakis, C.A.; Tichomirowa, M.A.; Boikos, S.; Azevedo, M.F.; Lodish, M.; Martari, M.; Verma, S.; Daly, A.F.; Raygada, M.; Keil, M.F.; et al. The role of germline AIP, MEN1, PRKAR1A, CDKN1B and CDKN2C mutations in causing pituitary adenomas in a large cohort of children, adolescents, and patients with genetic syndromes. Clin. Genet. 2010, 78, 457–463. [Google Scholar] [CrossRef] Mouchtouris, N.; Smit, R.D.; Piper, K.; Prashant, G.; Evans, J.J.; Karsy, M. A review of multiomics platforms in pituitary adenoma pathogenesis. Front. Biosci. 2022, 27, 77. [Google Scholar] [CrossRef] [PubMed] Bolz, H.; von Brederlow, B.; Ramirez, A.; Bryda, E.C.; Kutsche, K.; Nothwang, H.G.; Seeliger, M.; del, C.S.C.M.; Vila, M.C.; Molina, O.P.; et al. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D. Nat. Genet. 2001, 27, 108–112. [Google Scholar] [CrossRef] [PubMed] Zhang, S.; Cui, Y.; Ma, X.; Yong, J.; Yan, L.; Yang, M.; Ren, J.; Tang, F.; Wen, L.; Qiao, J. Single-cell transcriptomics identifies divergent developmental lineage trajectories during human pituitary development. Nat. Commun. 2020, 11, 5275. [Google Scholar] [CrossRef] Cheung, L.Y.; Davis, S.W.; Brinkmeier, M.L.; Camper, S.A.; Perez-Millan, M.I. Regulation of pituitary stem cells by epithelial to mesenchymal transition events and signaling pathways. Mol. Cell. Endocrinol. 2017, 445, 14–26. [Google Scholar] [CrossRef] Shintani, A.; Higuchi, M. Isolation of PRRX1-positive adult pituitary stem/progenitor cells from the marginal cell layer of the mouse anterior lobe. Stem Cell. Res. 2021, 52, 102223. [Google Scholar] [CrossRef] Yoshida, S.; Nishimura, N.; Ueharu, H.; Kanno, N.; Higuchi, M.; Horiguchi, K.; Kato, T.; Kato, Y. Isolation of adult pituitary stem/progenitor cell clusters located in the parenchyma of the rat anterior lobe. Stem Cell. Res. 2016, 17, 318–329. [Google Scholar] [CrossRef] Laporte, E.; Vennekens, A.; Vankelecom, H. Pituitary Remodeling Throughout Life: Are Resident Stem Cells Involved? Front. Endocrinol. 2020, 11, 604519. [Google Scholar] [CrossRef] [PubMed] Vankelecom, H.; Roose, H. The Stem Cell Connection of Pituitary Tumors. Front. Endocrinol. 2017, 8, 339. [Google Scholar] [CrossRef] [PubMed] Mertens, F.; Gremeaux, L.; Chen, J.; Fu, Q.; Willems, C.; Roose, H.; Govaere, O.; Roskams, T.; Cristina, C.; Becu-Villalobos, D.; et al. Pituitary tumors contain a side population with tumor stem cell-associated characteristics. Endocr. Relat. Cancer 2015, 22, 481–504. [Google Scholar] [CrossRef] [PubMed] Chen, H.Z.; Tsai, S.Y.; Leone, G. Emerging roles of E2Fs in cancer: An exit from cell cycle control. Nat. Rev. Cancer 2009, 9, 785–797. [Google Scholar] [CrossRef] [PubMed] Xu, Q.; Yuan, X.; Tunici, P.; Liu, G.; Fan, X.; Xu, M.; Hu, J.; Hwang, J.Y.; Farkas, D.L.; Black, K.L.; et al. Isolation of tumour stem-like cells from benign tumours. Br. J. Cancer 2009, 101, 303–311. [Google Scholar] [CrossRef] [PubMed] Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). From https://www.mdpi.com/2073-4409/11/21/3344/htm
  8. Objective: The first-line treatment for Cushing’s disease is transsphenoidal surgery, after which the rates of remission are 60 to 80%, with long-term recurrence of 20 to 30%, even in those with real initial remission. Drug therapies are indicated for patients without initial remission or with surgical contraindications or recurrence, and ketoconazole is one of the main available therapies. The objective of this study was to evaluate the safety profile of and the treatment response to ketoconazole in Cushing’s disease patients followed up at the endocrinology outpatient clinic of a Brazilian university hospital. Patients and methods: This was a retrospective cohort of Cushing’s disease patients with active hypercortisolism who used ketoconazole at any stage of follow-up. Patients who were followed up for less than 7 days, who did not adhere to treatment, or who were lost to follow-up were excluded. Results: Of the 172 Cushing’s disease patients who were followed up between 2004 and 2020, 38 received ketoconazole. However, complete data was only available for 33 of these patients. Of these, 26 (78%) underwent transsphenoidal surgery prior to using ketoconazole, five of whom (15%) had also undergone radiotherapy; seven used ketoconazole as a primary treatment. Ketoconazole use ranged from 14 days to 14.5 years. A total of 22 patients had a complete response (66%), three patients had a partial response (9%), and eight patients had no response to treatment (24%), including those who underwent radiotherapy while using ketoconazole. Patients whose hypercortisolism was controlled or partially controlled with ketoconazole had lower baseline 24-h urinary free cortisol levels than the uncontrolled group [times above the upper limit of normal: 0.62 (SD, 0.41) vs. 5.3 (SD, 8.21); p < 0.005, respectively] in addition to more frequent previous transsphenoidal surgery (p < 0.04). The prevalence of uncontrolled patients remained stable over time (approximately 30%) despite ketoconazole dose adjustments or association with other drugs, which had no significant effect. One patient received adjuvant cabergoline from the beginning of the follow-up, and it was prescribed to nine others due to clinical non-response to ketoconazole alone. Ten patients (30%) reported mild adverse effects, such as nausea, vomiting, dizziness, and loss of appetite. Only four patients had serious adverse effects that warranted discontinuation. There were 20 confirmed episodes of hypokalemia among 10/33 patients (30%). Conclusion: Ketoconazole effectively controlled hypercortisolism in 66% of Cushing’s disease patients, being a relatively safe drug for those without remission after transsphenoidal surgery or whose symptoms must be controlled until a new definitive therapy is carried out. Hypokalemia is a frequent metabolic effect not yet described in other series, which should be monitored during treatment. Introduction Cushing’s disease (CD) results from a pituitary tumor that secretes adrenocorticotropic hormone (ACTH), which leads to chronic hypercortisolism. It is a potentially fatal disease with high morbidity and a mortality rate of up to 3.7 times than that of the general population (1–4) associated to several clinical–metabolic disorders caused by excess cortisol and/or loss of circadian rhythm (5). In general, its management is a challenge even in reference centers (6, 7). Transsphenoidal surgery (TSS), the treatment of choice for CD, results in short-term remission in 60 to 80% of patients (8). However, recurrence rates of 20 to 30% are found in long-term follow-up, even in those with clear initial remission (9). Drug therapies can help control excess cortisol in patients without initial remission, in cases of recurrence, and in those with contraindications or high initial surgical risk (10). Nevertheless, specific drugs that act on the pituitary adenoma, which could directly treat excess ACTH, have a limited effect, and only pasireotide is approved for this purpose in Brazil (11, 12). In this scenario, adrenal steroidogenesis blockers are important. One such off-label medication is the antifungal drug ketoconazole, a synthetic imidazole derivative that inhibits the enzymes CYP11A1, CYP17, CYP11B2, and CYP11B1. Because of its hepatotoxicity and the availability of other drugs, it has been withdrawn from the market in several countries (13). In Europe, it is still approved for use in CD, although in the United States, it is recommended for off-label use almost in CD (14–16). Due to the potential benefits for hypercortisolism, ketoconazole has been replaced by levoketoconazole, which the European Union has recently approved for CD with a lower expected hepatotoxicity (17). Thus, when adrenal inhibitors are used as an alternative treatment for CD, information about the outcomes of drugs such as ketoconazole are important. Clinical studies on these effects in CD are scarce, mostly retrospective, multicenter, or from developed countries (14, 18). A recent meta-analysis on the therapeutic modalities for CD included only four studies (246 patients) that evaluated urinary cortisol response as a treatment outcome and eight studies (366 patients) describing the prevalence of some side effects: change in transaminase activity, digestive symptoms, skin rash, and adrenal insufficiency. Hypokalemia was not mentioned in this meta-analysis (19). The objective of this study was to evaluate the safety profile of and treatment response to ketoconazole in CD patients followed during a long term in the endocrinology outpatient clinic of a Brazilian university hospital. Patients and methods Patients We retrospectively evaluated 38 patients (27 women) diagnosed with CD. These patients, whose treatment included ketoconazole at any time between 2004 and 2020, are part of a prospective cohort series from the Hospital de Clínicas de Porto Alegre neuroendocrinology outpatient clinic. The diagnostic criteria for hypercortisolism were based on high 24-h urinary free cortisol levels (24-h UFC) in at least two samples, non-suppression of serum cortisol after low-dose dexamethasone testing (>1.8 µg/dl), and/or loss of cortisol rhythm (midnight serum cortisol >7.5 µg/dl or midnight salivary cortisol >0.208 nmol/L). CD was diagnosed by normal or elevated ACTH levels, evidence of pituitary adenoma >0.6 cm on magnetic resonance image (MRI), and ACTH central/periphery gradient on inferior petrosal sinus catheterization when MRI was normal or showed an adenoma <0.6 cm. CD was considered to be in remission after the improvement of hypercortisolism symptoms or clinical signs of adrenal insufficiency, associated with serum cortisol within reference values, normalization of 24-h UFC and/or serum cortisol <1.8 μg/dl at 8 am after 1 mg dexamethasone overnight, and/or normalization of midnight serum or salivary cortisol. In patients with active disease, to evaluate the ketoconazole treatment response, 24-h UFC was used as a laboratory parameter, as recommended in similar publications (14, 16, 20, 21), but in some cases, we considered elevated late night salivary cortisol and/or 1 mg dexamethasone overnight cortisol (even with normal 24-h UFC), given the greater assessment sensitivity seen through these two methods in the detection of early recurrence when compared with 24-h UFC (22). Inclusion criteria We included patients with CD and active hypercortisolism who used ketoconazole either as primary treatment, after TSS without hypercortisolism remission, or after a recurrence. Exclusion criteria We excluded patients with CD and active hypercortisolism who used ketoconazole but had <7 days of follow-up, irregular outpatient follow-up, treatment non-adherence, and incomplete medical records or those who were lost to follow-up. Evaluated parameters Prior to ketoconazole treatment, all patients underwent an assessment of pituitary function and hypercortisolism, including serum cortisol, ACTH, 24-hour UFC, cortisol suppression after 1 mg dexamethasone overnight, midnight serum cortisol, and/or midnight salivary cortisol. The evaluated parameters were sex, age at diagnosis, weight, height, prevalence and severity of hypertension and DM, pituitary tumor characteristics, prior treatment (surgery, radiotherapy, or other medications), symptoms at disease onset, biochemical tests (renal function, hepatic function, and lipid profile), number of medications used to treat associated comorbidities, data on medication tolerance, and reasons for discontinuation, when necessary. The clinical parameters observed during treatment were control of blood pressure and hyperglycemia, anthropometric measurements (weight, height, and body mass index), jaundice, and any other symptoms or adverse effects reported by patients. The biochemical evaluation included fasting glucose, glycated hemoglobin, lipid profile (total cholesterol, high-density lipoprotein, low-density lipoprotein, and triglycerides), markers of liver damage (transaminases, bilirubin, gamma-glutamyl transferase, and alkaline phosphatase), electrolytes (sodium and potassium), and renal function (creatinine and urea). Hypecortisolism was accessed preferentially by 24-h UFC, however, late-night salivary cortisol and cortisol after 1 mg overnight dexamethasone could also be used. Study design This retrospective cohort study included patients with CD who were followed up at the Hospital de Clínicas de Porto Alegre Endocrinology Division, with their medical records from the first outpatient visit and throughout clinical follow-up collected. This study was approved by the Hospital de Clínicas de Porto Alegre Research Ethics Committee (number 74555617.0.0000.5327). Outcomes Hypercortisolism was considered controlled when the 24-h UFC and/or late-night salivary cortisol (LNSC) and/or overnight 1 mg dexamethasone suppression test (DST) levels were normalized in at least two consecutive assessments. Hypercortisolism was considered partially controlled when there was a 50% over-reduction in 24-h UFC and/or LNSC and/or DST levels but still above normal. A reduction lower than 50% in these parameters was considered as non-response. We also assessed the ketoconazole doses that resulted in 24-h UFC normalization, maximum dose, medication tolerance, adverse effects, and changes in liver, kidney, and biochemical function. Due to the characteristics of this study, these outcomes were periodically evaluated in all patient consultations, which occurred usually every 2 to 4 months. Data collection This retrospective cohort evaluated outpatient medical records and any tests indicated by the attending physician as a pragmatic study. Ketoconazole use followed the department’s care protocol, which is based on national and international guidelines (4), and all patients received a similar care routine: the recommended initial prescription was generally taken in two to six doses at 100 to 300 mg/day. It was then increased by 200 mg every 2 to 4 months until hypercortisolism was controlled or side effects developed, especially those related to liver function. The maximum prescription was 1,200 mg/day. Clinical follow-up of these patients was performed 30 days after starting the medication and every 2–4 months thereafter (23). Clinical, anthropometric, laboratory, and other exam data were collected through a review of the hospital’s electronic medical records for the entire follow-up period. Data from the first and last consultation were considered in the final analysis of all parameters. Statistical analysis Baseline population characteristics were described as mean and standard deviation (SD) or median with interquartile ranges (25–75) for continuous variables. The chi-square test was used to compare qualitative variables, and Student’s t-test or ANOVA was used to compare the quantitative variables. The Mann–Whitney U-test was used for unpaired data. P-values <0.05 were considered significant. Statistical analysis was performed in SPSS 18.0 (SPSS Inc., Chicago, IL, USA) and R package geepack 1.3-1. Results Treatment with ketoconazole was indicated for 41 of the 172 CD patients. In 3/41 patients, ketoconazole was unallowed due to concomitant liver disease, and 38 received ketoconazole during CD treatment between 2004 and 2020. Of these, five were excluded due to insufficient data to determine the response to ketoconazole (short treatment time, irregular follow-up, incomplete medical records, or lost to follow-up). The baseline characteristics of every sample are shown in Table 1. Thus, 33/41 patients were included in the final analysis. The patients were predominantly women (84.2%) and white (89.5%); 11 had microadenoma, 15 had macroadenoma, and 11 had no adenoma visualized. In 12/33 patients, pituitary imaging was not performed immediately before starting ketoconazole. Hypertension was observed in 26 patients (78%) and DM in 12 patients (36%). The mean age at CD diagnosis was 31.7 years. Table 1 TABLE 1 Baseline clinical data of Cushing’s disease patients treated with ketoconazole. Of the 33 patients with complete data, 26 (78%) underwent TSS prior to starting ketoconazole, five of whom (15%) had also undergone radiotherapy. Thus, seven patients used ketoconazole as primary treatment since performing a surgical procedure was impossible at that time. Of these, four had no response to ketoconazole, one had a partial response, and two had a complete response. At follow-up, four of these patients underwent their first TSS, and three continued the ketoconazole therapy, achieving full UFC control. Among those who used ketoconazole after TSS (n = 26), 20 had a complete response, two had a partial response, and four had no response. Figure 1 shows the study flow chart and patient distribution throughout the treatment. Figure 1 FIGURE 1 Flowchart of ketoconazole treatment in Cushing's disease patients. Individual patient data are described in Table 2. The duration of ketoconazole use ranged from 14 days (in one patient who used it pre-TSS) to 14.5 years. The total follow-up time of the 22 patients with controlled CD ranged from 3 months to 14.5 years, with a mean of 5.33 years and a median of 4.8 years. Table 2 TABLE 2 Individual data. Therapeutic response Relative therapeutic response data are described in Table 3. Patients whose hypercortisolism was controlled or partially controlled with ketoconazole had lower baseline 24-h UFC than the uncontrolled group [times above the upper limit of normal: 0.62 (SD, 0.41) vs. 5.3 (SD, 8.21); p < 0.005, respectively], in addition to more frequent prior TSS (p < 0.04). In some patients (4/33), 24-h UFC was in the normal range at the beginning of ketoconazole therapy, but they were prescribed with the medication due to the clinical recurrence of CD associated to cortisol non-suppression after 1 mg dexamethasone overnight and/or abnormal midnight salivary or serum cortisol. Table 3 TABLE 3 Baseline characteristics of Cushing’s disease patients according to therapeutic response to ketoconazole. Figure 2 shows that the prevalence of uncontrolled patients remained stable over time (approximately 30%) despite dose adjustments or association with other drugs, which led to no differences. When analyzing only the results of the last follow-up visit (eliminating fluctuations during follow-up), 22 patients had a complete response (66%), three patients had a partial response (9%), and eight patients had no response to ketoconazole treatment (24%), which includes patients who underwent radiotherapy during ketoconazole treatment. Figure 2 FIGURE 2 Prevalence of controlled hypercortisolism during follow-up of Cushing's disease patients treatesd with ketoconazole. During follow-up, no significant differences were found in blood pressure control or in dehydroepiandrosterone sulfate, cortisol, ACTH, or glucose levels. Worsening of hypertension control was observed in association with hypokalemia in some cases, as described in side effects. The ketoconazole doses ranged from 100 to 1,200 mg per day, and there were no significant dose or response differences between the groups (Table 4). Figure 3 shows the patients, their dosages, and 24-h UFC control at the first and last consultation, showing a trend toward hypercortisolism reduction in approximately 70% of the cohort (25 of 33). Only four patients used doses lower than 300 mg at the end of follow-up. One of them used before TSS and suspended its use after surgery. One patient, who has already undergone radiotherapy, discontinued ketoconazole due to intolerance, despite adequate control of hypercortisolism. Another one, who had also undergone radiotherapy, was lost to follow-up when it was controlled using 100 mg daily, and one remained controlled using 200 mg, without previous radiotherapy. Table 4 TABLE 4 Final dose of ketoconazole used in patients with Cushing’s disease. Figure 3 FIGURE 3 First and last consultation 24çhour UFC results vs. ketoconazole dosage in Cushing's disease patients. Side effects Regarding adverse effects (Table 5), there was no significant difference between the controlled/partially controlled group and the uncontrolled group regarding liver enzyme changes or drug intolerance. Mild adverse effects, including nausea, vomiting, dizziness, and loss of appetite, occurred in 10 patients (30%). Only four patients had serious adverse effects that warranted discontinuing the medication. In two cases, ketoconazole was discontinued due to a significantly acute increase in liver enzymes (drug-induced hepatitis) during the use of 400 and 800 mg of ketoconazole. Non-significant elevation of transaminases (up to three times the normal value) was observed in three cases. A slight increase in gamma-glutamyltransferase occurred in six patients. In these nine patients with elevated liver markers, the daily dose ranged from 400 to 1,200 mg. None of those with mild increases in liver markers needed to discontinue ketoconazole. Table 5 TABLE 5 Adverse effects of ketoconazole in Cushing’s disease patients treated with ketoconazole. One female patient developed pseudotumor cerebri syndrome, which was treated with acetazolamide. She did not need to discontinue ketoconazole, having used it for more than 10 years without new side effects and achieving complete control of hypercortisolism (24). Another patient became pregnant during follow-up while using the medication, but no maternal or fetal complications occurred (25). Hypokalemia was also observed during follow-up. Twenty episodes of reduced potassium levels occurred in 10 patients over the course of treatment. Of these episodes, six occurred in controlled patients, three in partially controlled patients, and 11 in uncontrolled patients (Table 6). The hypokalemia was managed with spironolactone (25 to 100 mg) and oral potassium supplementation. Table 6 TABLE 6 Characteristics of Cushing’s disease patients who developed hypokalemia during ketoconazole treatment. Ketoconazole and associations Of the patients who used an association of cabergoline and ketoconazole, one did so since the beginning of follow-up, while another nine were prescribed cabergoline during follow-up due to non-response to ketoconazole alone. Of these 10 patients, two did not start the medication due to problems in obtaining the drug. Thus, in two of the nine patients on the maximum tolerated dose of ketoconazole or who could not tolerate a higher dose due to hepatic enzymatic changes, 1.5–4.5 mg of cabergoline per week was associated. In patients not controlled with ketoconazole plus cabergoline, mitotane (two patients) or pasireotide (two patients) was added. Only two of nine patients responded to the combination of cabergoline and ketoconazole. Data on these associations are shown in Table 7. Table 7 TABLE 7 Effects of associating cabergoline with ketoconazole in Cushing’s disease patients. Considering that one of the indications for the treatment of hypercortisolism may be complementary to radiotherapy, we analyzed the eight patients who underwent radiotherapy after transsphenoidal surgery. In these patients, doses of ketoconazole from 200 to 1,200 mg were used, and in six patients there was a normalization of the UFC in 1 to 60 months of treatment. Thus, the association of ketoconazole with radiotherapy was effective in normalizing the 24-h UFC in 75% of cases. Clinical follow-up New therapeutic approaches were attempted in some patients during follow-up: radiotherapy (eight patients), new TSS (five patients), and bilateral adrenalectomy (four patients). At the end of this analysis, 11 patients remained on ketoconazole, all with controlled hypercortisolism. Among the 11 patients who were not fully controlled by the last visit, five were using ketoconazole as pre-TSS therapy and underwent TSS as soon as possible, while three others underwent radiotherapy and two underwent bilateral adrenalectomy. One patient was lost to follow-up. Discussion According to the current consensus about CD, drug treatment should be reserved for patients without remission after TSS, those who cannot undergo surgical treatment, or those awaiting the effects of radiotherapy (4, 16). Drugs available in this context may act as adrenal steroidogenesis blockers (ketoconazole, osilodrostat, metyrapone, mitotane, levoketoconazole, and etomidate), in pituitary adenoma (somatostatinergic receptor ligands—pasireotide), dopamine receptor agonists (cabergoline), or glucocorticoid receptor blockers (mifepristone) (16, 26). Among these alternatives, the drug of choice still cannot be determined. Thus, the best option must be established individually, considering aspects such as remission potential, safety profile, availability, cost, etc. (16, 27, 28). For over 30 years, ketoconazole has been prescribed off-label for CD patients with varied rates of remission of hypercortisolism, and it can be used in monotherapy or associated with other drugs (29, 30). The Brazilian public health system does not provide drugs for the treatment of CD, and among medications with a better profile for controlling hypercortisolism, such as osilodrostat, levoketoconazole, and pasireotide, only pasireotide has been approved by the national regulatory authority (ANVISA). Due to such pragmatic considerations, ketoconazole is among the most commonly used drugs in our health system, whether recently associated or not with cabergoline (7). In this cohort, the most prevalent response type was complete (66%). Since 75% of the CD patients who used ketoconazole had a complete or partial response, there was a clear trend towards improvement in hypercortisolism. When only those who used ketoconazole post-TSS were evaluated, the rate of control increased to 76%. We found that patients with a higher initial 24-h UFC tended to have less control of excess cortisol, a difference that was not observed when analyzing ketoconazole dose or follow-up time. In our series and at the prescribed doses, the combination of cabergoline and ketoconazole was not effective in the management of hypercortisolism since only two of nine patients (22%) had their 24-hour UFC normalized. However, it should be observed that this association was used in patients who had more severe CD and, consequently, were less likely to have a favorable response. The effects of cabergoline in CD patients remain controversial, although some studies have shown promising responses (31, 32). Previous reviews found that the efficacy of ketoconazole for hypercortisolism control was quite heterogeneous, ranging from 14 to 100% in 99 patients (33, 34). Our cohort’s response rate was lower than that of Sonino et al. (89%) (20) but higher than that of a multicenter cohort by Castinetti et al. (approximately 50%) (14). Regarding other smaller series (35–37) our results reinforce some findings that demonstrate a percentage of control greater than 50% of the cases. Our analyses showed a trend toward a response that continued, with some oscillations, over time. The rate of uncontrolled patients remained stable over time (approximately 30%), regardless of association with other drugs (cabergoline, mitotane, or pasireotide) or dose adjustments. Speculatively, it would appear that patients who respond to ketoconazole treatment would show some type of response as soon as therapy begins. Our cohort has the longest follow-up time of any study on ketoconazole use in CD, nearly 15 years. Our results demonstrate that patients who benefit from ketoconazole (i.e., control of hypercortisolism and associated comorbidities) can safely use it for a long term since those who did not experience liver enzyme changes at the beginning of treatment also had no long-term changes. Another relevant information for clinical practice is the result of treatment with ketoconazole associated with radiotherapy, which demonstrated normalizing the 24-h UFC in 75% of cases, a finding that reinforces the use of this therapeutic combination, especially in cases that are more resistant to different treatment modalities. As described in the literature, adverse effects, such as nausea, vomiting, dizziness, headache, loss of appetite, and elevated transaminases, are relatively frequent (38). In our cohort, 10 patients (30%) had mild adverse effects, and four (12%) had more serious adverse effects requiring discontinuation. In other studies, up to 20% of patients required discontinuation due to side effects (14). We documented 20 episodes of hypokalemia during ketoconazole treatment, some with worsening blood pressure control. In most cases, hypokalemia has occurred in association with the use of diuretic drugs, which may have potentiated potassium spoliation, reinforcing the need of stringent surveillance in hypertensive Cushing’s disease patients using this combination. It can also result from the enzymatic blockade that could lead to the elevation of adrenal mineralocorticoid precursors (pex. deoxycorticosterone), with consequent sodium retention and worsening hypertension. Although it has not been analyzed in other series with ketoconazole, this side effect has been observed in patients who received other adrenal-blocking drugs, such as osilodrostat and metyrapone (16). This alteration seems to be transient in some patients; in our series, it was managed by suspending drugs that could worsen hypokalemia and introducing spironolactone and/or potassium supplementation. Hypokalemia may also result from continuing intense adrenal stimulation by ACTH and changes in the activity of the 11-beta-hydroxysteroid dehydrogenase enzyme, which increase the mineralocorticoid activity of cortisol, as observed in patients with severe hypercortisolism in uncontrolled CD (39). Hypogonadism occurred in one male patient. In two adolescent patients (one female and one male), hypercortisolism was effectively controlled without altering the progression of puberty. As described in other cohorts, this effect was expected due to the high doses, which block adrenal and testicular androgen production (20). Thus, our findings confirm previous reports in the literature and add important information about the side effects and safety of long-term ketoconazole use in CD treatment. Our data reinforce the current recommendations about ketoconazole for recurrent cases or those refractory to surgery, including proper follow-up by an experienced team specializing in evaluating clinical and biochemical responses and potential adverse effects (7, 18, 40). Despite the severity of many of our CD patients, no ketoconazole-related death occurred during follow-up, including long-term observation. On the other hand, no patient progressed to definitive remission of hypercortisolism, even after many years of treatment with ketoconazole. Conclusions In our cohort of patients, ketoconazole proved to be an effective and safe alternative for CD treatment, although it can produce side effects that require proper identification and management, allowing effective long-term treatment. We found side effects that have been rarely described in the literature, including hypokalemia and worsening hypertension, which require specific care and management. Thus, ketoconazole is an effective alternative for CD patients who cannot undergo surgery, who do not achieve remission after pituitary surgery, or who have recurrent hypercortisolism. Data availability statement The raw data supporting the conclusions of this article will be made available by the authors without undue reservation. Ethics statement The studies involving human participants were reviewed and approved by the Hospital de Clínicas de Porto Alegre Research Ethics Committee. Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements. Author contributions CV and MAC created the research format. CV, RBM, and MCBC realized the search on medical records. CV performed the statistical analysis. MAC, ACVM, and TCR participated in the final data review and discussion. ACVM participated in the final data review and discussion as volunteer collaborator. All authors contributed to the article and approved the submitted version. Funding This work was supported by the “Coordenação de Aperfeiçoamento de Pessoal de Nı́vel Superior” (CAPES), Ministry of Health - Brazil, through a PhD scholarship; and the Research Incentive Fund (FIPE) of Hospital de Clı́nicas de Porto Alegre. Acknowledgments The authors would like to thank the HCPA Research and Graduate Studies Group (GPPG) for the statistical technical support provided by Rogério Borges. We also thank the Research Incentive Fund of Hospital de Clínicas de Porto Alegre and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), by funds applied. We also thank the Graduate Program in Endocrinology and Metabolism (PPGEndo UFRGS) for all the support in the preparation of this research. Conflict of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher’s note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Fleseriu M, Castinetti F. Updates on the role of adrenal steroidogenesis inhibitors in cushing’s syndrome: a focus on novel therapies. Pituitary (2016) 19(6):643–53. doi: 10.1007/s11102-016-0742-1 PubMed Abstract | CrossRef Full Text | Google Scholar 2. Pivonello R, De Leo M, Cozzolino A, Colao A. The treatment of cushing’s disease. Endocr Rev (2015) 36(4):385–486. doi: 10.1210/er.2013-1048 PubMed Abstract | CrossRef Full Text | Google Scholar 3. Nieman LK, Biller BMK, Findling JW, Newell-Price J, Savage MO, Stewart PM, et al. The diagnosis of cushing’s syndrome: An endocrine society clinical practice guideline. J Clin Endocrinol Metab (2008) 93(5):1526–40. doi: 10.1210/jc.2008-0125 PubMed Abstract | CrossRef Full Text | Google Scholar 4. Nieman LK, Biller BMK, Findling JW, Murad MH, Newell-Price J, Savage MO, et al. Treatment of cushing’s syndrome: An endocrine society clinical practice guideline. J Clin Endocrinol Metab (2015) 100(8):2807–31. doi: 10.1210/jc.2015-1818 PubMed Abstract | CrossRef Full Text | Google Scholar 5. Pivonello R, De Martino M, De Leo M, Lombardi G, Colao A. Cushing’s syndrome. Endocrinol Metab Clin North (2008) 37(1):135–49. doi: 10.1016/j.ecl.2007.10.010 CrossRef Full Text | Google Scholar 6. Alexandraki KI, Grossman AB. Therapeutic strategies for the treatment of severe cushing’s syndrome. Drugs (2016) 76(4):447–8. doi: 10.1007/s40265-016-0539-6 PubMed Abstract | CrossRef Full Text | Google Scholar 7. Machado MC, Fragoso MCBV, Moreira AC, Boguszewski CL, Neto LV, Naves LA, et al. A review of cushing’s disease treatment by the department of neuroendocrinology of the Brazilian society of endocrinology and metabolism. Arch Endocrinol Metab (2018) 62(1):87–105. doi: 10.20945/2359-3997000000014 PubMed Abstract | CrossRef Full Text | Google Scholar 8. Rollin G, Ferreira NP, Czepielewski MA. Prospective evaluation of transsphenoidal pituitary surgery in 108 patients with Cushing's disease. Arq Bras Endocrinol Metabol. (2007) 51(8):1355–61. doi: 10.1590/s0004-27302007000800022 PubMed Abstract | CrossRef Full Text | Google Scholar 9. Patil CG, Prevedello DM, Lad SP, Lee Vance M, Thorner MO, Katznelson L, et al. Late recurrences of cushing’s disease after initial successful transsphenoidal surgery. J Clin Endocrinol Metab (2008) 93(2):358–62. doi: 10.1210/jc.2007-2013 PubMed Abstract | CrossRef Full Text | Google Scholar 10. Rubinstein G, Osswald A, Zopp S, Ritzel K, Theodoropoulou M, Beuschlein F, et al. Therapeutic options after surgical failure in cushing’s disease: A critical review. Best Pract Res Clin Endocrinol Metab (2019) 33(2):101270. doi: 10.1016/j.beem.2019.04.004 PubMed Abstract | CrossRef Full Text | Google Scholar 11. Zhao N, Yang X, Li C, Yin X. Efficacy and safety of pasireotide for Cushing's disease: A protocol for systematic review and meta-analysis. Medicine (Baltimore). (2020) 99(51):e23824. doi: 10.1097/MD.0000000000023824 PubMed Abstract | CrossRef Full Text | Google Scholar 12. Pivonello R, Fleseriu M, Newell-Price J, Bertagna X, Findling J, Shimatsu A, et al. Efficacy and safety of osilodrostat in patients with cushing’s disease (LINC 3): a multicentre phase III study with a double-blind, randomised withdrawal phase. Lancet Diabetes Endocrinol (2020) 8(9):748–61. doi: 10.1016/S2213-8587(20)30240-0 PubMed Abstract | CrossRef Full Text | Google Scholar 13. Yan JY, Nie XL, Tao QM, Zhan SY, De Zhang Y. Ketoconazole associated hepatotoxicity: A systematic review and meta-analysis. Biomed Environ Sci (2013) 26(7):605–10. doi: 10.3967/0895-3988.2013.07.013 PubMed Abstract | CrossRef Full Text | Google Scholar 14. Castinetti F, Guignat L, Giraud P, Muller M, Kamenicky P, Drui D, et al. Ketoconazole in cushing’s disease: Is it worth a try. J Clin Endocrinol Metab (2014) 99(5):1623–30. doi: 10.1210/jc.2013-3628 PubMed Abstract | CrossRef Full Text | Google Scholar 15. Castinetti F, Nieman LK, Reincke M, Newell-Price J. Approach to the patient treated with steroidogenesis inhibitors. J Clin Endocrinol Metab (2021) 106(7):2114–23. doi: 10.1210/clinem/dgab122 PubMed Abstract | CrossRef Full Text | Google Scholar 16. Fleseriu M, Auchus R, Bancos I, Bem-Shlomo A, Bertherat J, Biermasz NR, et al. Consensus on diagnosis and management of cushing’s disease: a guideline update. Lancet Diabetes Endocrinol (2021) 9(12):847–75. doi: 10.1016/s2213-8587(21)00235-7 PubMed Abstract | CrossRef Full Text | Google Scholar 17. Fleseriu M, Pivonello R, Elenkova A, Salvatori R, Auchus RJ, Feelders RA, et al. Efficacy and safety of levoketoconazole in the treatment of endogenous cushing’s syndrome (SONICS): a phase 3, multicentre, open-label, single-arm trial. Lancet Diabetes Endocrinol (2019) 7(11):855–65. doi: 10.1016/S2213-8587(19)30313-4 PubMed Abstract | CrossRef Full Text | Google Scholar 18. Tritos NA. Adrenally directed medical therapies for cushing syndrome. J Clin Endocrinol Metab (2021) 106(1):16–25. doi: 10.1210/clinem/dgaa778 PubMed Abstract | CrossRef Full Text | Google Scholar 19. Simões Corrêa Galendi J, Correa Neto ANS, Demetres M, Boguszewski CL, dos S V. N. nogueira, “Effectiveness of medical treatment of cushing’s disease: A systematic review and meta-analysis,”. Front Endocrinol (Lausanne) (2021) 12:732240(September). doi: 10.3389/fendo.2021.732240 PubMed Abstract | CrossRef Full Text | Google Scholar 20. Sonino N, Boscaro M, Paoletta A, Mantero F, Zillotto D. Ketoconazole treatment in cushing’s syndrome: experience in 34 patients. Clin Endocrinol (Oxf) (1991) 35(4):347–52. doi: 10.1111/j.1365-2265.1991.tb03547.x PubMed Abstract | CrossRef Full Text | Google Scholar 21. Costenaro F, Rodrigues TC, Rollin GAF, Czepielewski MA. Avaliação do eixo hipotálamohipófise adrenal no diagnóstico e na remissão da doença de cushing. Arquivos Brasileiros Endocrinologia e Metabologia (2012). doi: 10.1590/S0004-27302012000300002 CrossRef Full Text | Google Scholar 22. Amlashi FG, Swearinger B, Faje AT, Nachtigall LB, Miller KK, Klibanski A, et al. Accuracy of late-night salivary cortisol in evaluating postoperative remission and recurrence in cushing’s disease. J Clin Endocrinol Metab (2015) 100(10):3770–7. doi: 10.1210/jc.2015-2107 PubMed Abstract | CrossRef Full Text | Google Scholar 23. Silveiro SP, Satler F. Rotinas em endocrinologia. (Porto Alegre: Artmed) (2015). Google Scholar 24. Costenaro F, Rodrigues TC, Ferreira NP, da Costa TG, Schuch T, Boschi V, et al. Pseudotumor cerebri during cushing’s disease treatment with ketoconazole. Arq. Bras Endocrinol Metabol (2011). doi: 10.1590/s0004-27302011000400008 CrossRef Full Text | Google Scholar 25. Costenaro F, Rodrigues TC, De Lima PB, Ruszczyk J, Rollin G, Czepielewski MA. A successful case of cushing’s disease pregnancy treated with ketoconazole. Gynecol Endocrinol (2015) 31(3):176–8. doi: 10.3109/09513590.2014.995615 PubMed Abstract | CrossRef Full Text | Google Scholar 26. Gadelha MR, Neto LV. Efficacy of medical treatment in cushing’s disease: A systematic review. Clin Endocrinol (Oxf) (2014) 80(1):1–12. doi: 10.1111/cen.12345 PubMed Abstract | CrossRef Full Text | Google Scholar 27. Fleseriu M, Petersenn S. New avenues in the medical treatment of cushing’s disease: Corticotroph tumor targeted therapy. J Neurooncol (2013) 114(1):1–11. doi: 10.1007/s11060-013-1151-1 PubMed Abstract | CrossRef Full Text | Google Scholar 28. Fleseriu M, Petersenn S. Medical management of cushing’s disease: What is the future? Pituitary (2012) 15(3):330–41. doi: 10.1007/s11102-012-0397-5 PubMed Abstract | CrossRef Full Text | Google Scholar 29. Feelders RA, De Bruin C, Pereira AM, Romijn JÁ, Netea-Maier RT, Hermus AR, et al. Pasireotide alone or with cabergoline and ketoconazole in cushing’s disease. N Engl J Med (2010) 362(19):1846–8. doi: 10.1056/NEJMc1000094 PubMed Abstract | CrossRef Full Text | Google Scholar 30. Barbot M, Albiger N, Ceccato F, Zilio M, Frigo AC, Denaro Lc, et al. Combination therapy for cushing’s disease: Effectiveness of two schedules of treatment. should we start with cabergoline or ketoconazole? Pituitary (2014) 17(2):109–17. doi: 10.1007/s11102-013-0475-3 PubMed Abstract | CrossRef Full Text | Google Scholar 31. Vilar L, Naves LA, Azevedo MF, Arruda MJ, Arahata CM, Silva LM, et al. Effectiveness of cabergoline in monotherapy and combined with ketoconazole in the management of cushing’s disease. Pituitary (2010) 13(2):123–9. doi: 10.1007/s11102-009-0209-8 PubMed Abstract | CrossRef Full Text | Google Scholar 32. Pivonello R, De Martino MC, Cappabianca P, De Leo M, Faggiano A, Lombardi G, et al. The medical treatment of cushing’s disease: Effectiveness of chronic treatment with the dopamine agonist cabergoline in patients unsuccessfully treated by surgery. J Clin Endocrinol Metab (2009) 94(1):223–30. doi: 10.1210/jc.2008-1533 PubMed Abstract | CrossRef Full Text | Google Scholar 33. Castinetti F, Morange I, Jaquet P, Conte-Devolx B, Brue T. Ketoconazole revisited: A preoperative or postoperative treatment in cushing’s disease. Eur J Endocrinol (2008). doi: 10.1530/EJE-07-0514 PubMed Abstract | CrossRef Full Text | Google Scholar 34. Loli P, Berselli ME, Tagliaferri M. Use of ketoconazole in the treatment of cushing’s syndrome. J Clin Endocrinol Metab (1986) 63(6):1365–71. doi: 10.1210/jcem-63-6-1365 PubMed Abstract | CrossRef Full Text | Google Scholar 35. Kakade HR, Kasaliwal R, Khadilkar KS, Jadhav S, Bukan A, Khare Sc, et al. Clinical, biochemical and imaging characteristics of cushing’s macroadenomas and their long-term treatment outcome. Clin Endocrinol (Oxf) (2014) 81(3):336–42. doi: 10.1111/cen.12442 PubMed Abstract | CrossRef Full Text | Google Scholar 36. Luisetto G, Zangari M, Camozzi V, Boscaro M, Sonino N, Fallo F. Recovery of bone mineral density after surgical cure, but not by ketoconazole treatment, in cushing’s syndrome. Osteoporos Int (2001) 12(11):956–60. doi: 10.1007/s001980170025 PubMed Abstract | CrossRef Full Text | Google Scholar 37. Huguet I, Aguirre M, Vicente A, Alramadan M, Quiroga I, Silva J, et al. Assessment of the outcomes of the treatment of cushing’s disease in the hospitals of castilla-la mancha. Endocrinol y Nutr (2015) 62(5):217–23. doi: 10.1016/j.endonu.2015.02.007 CrossRef Full Text | Google Scholar 38. Tritos NA, Biller BMK. Advances in the medical treatment of cushing disease. Endocrinol Metab Clin North Am (2020) 49(3):401–12. doi: 10.1016/j.ecl.2020.05.003 PubMed Abstract | CrossRef Full Text | Google Scholar 39. Torpy D, Mullen N, Ilias I, Nieman L. Association of hypertension and hypokalemia with cushing’s syndrome caused by ectopic ACTH secretion. Ann N Y Acad Sci (2002) 970:134–44. doi: 10.1111/j.1749-6632.2002.tb04419.x PubMed Abstract | CrossRef Full Text | Google Scholar 40. Varlamov EV, Han AJ, Fleseriu M. “Updates in adrenal steroidogenesis inhibitors for cushing’s syndrome – a practical guide,”. Best Pract Res Clin Endocrinol Metab (2021) 35(1):101490. doi: 10.1016/j.beem.2021.101490 PubMed Abstract | CrossRef Full Text | Google Scholar Keywords: Cushing’s disease, Cushing’s syndrome, hypercortisolism, treatment, ketoconazole Citation: Viecceli C, Mattos ACV, Costa MCB, Melo RBd, Rodrigues TdC and Czepielewski MA (2022) Evaluation of ketoconazole as a treatment for Cushing’s disease in a retrospective cohort. Front. Endocrinol. 13:1017331. doi: 10.3389/fendo.2022.1017331 Received: 11 August 2022; Accepted: 06 September 2022; Published: 07 October 2022. Edited by: Luiz Augusto Casulari, University of Brasilia, Brazil Reviewed by: Juliana Drummond, Federal University of Minas Gerais, Brazil Monalisa Azevedo, University of Brasilia, Brazil Copyright © 2022 Viecceli, Mattos, Costa, Melo, Rodrigues and Czepielewski. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. *Correspondence: Mauro Antonio Czepielewski, maurocze@terra.com.br Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. From https://www.frontiersin.org/articles/10.3389/fendo.2022.1017331/full
  9. A prolactin (PRL) test measures how much of a hormone called prolactin you have in your blood. The hormone is made in your pituitary gland, which is located just below your brain. When women are pregnant or have just given birth, their prolactin levels increase so they can make breast milk. But it’s possible to have high prolactin levels if you’re not pregnant, and even if you’re a man. Your doctor may order a prolactin test when you report having the following symptoms: For women Irregular or no periods Infertility Breast milk discharge when you’re not pregnant or nursing Tenderness in your breast Menopausal symptoms such as hot flashes and vaginal dryness For men Decreased sex drive Difficulty in getting an erection Breast tenderness or enlargement Breast milk production (very rare) For both Unexplained headaches Vision problems Causes of Abnormal Prolactin Levels Normally, men and nonpregnant women have just small traces of prolactin in their blood. When you have high levels, this could be caused by: Prolactinoma (a benign tumor in your pituitary gland that produces too much prolactin) Diseases affecting the hypothalamus(the part of the brain that controls the pituitary gland) Anorexia(an eating disorder) Drugs that are used to treat depression, psychosis, and high blood pressure Chest injury or irritation (for example, scars, shingles, or even a bra that’s too tight) Also, kidney disease, liver failure, and polycystic ovarian syndrome (a hormone imbalance that affects ovaries) all can affect the body’s ability to remove prolactin. How the Test Is Done You don’t need to make any special preparations for a prolactin test. You will get a blood sample taken at a lab or a hospital. A lab worker will insert a needle into a vein in your arm to take out a small amount of blood. Some people feel just a little sting. Others might feel moderate pain and see slight bruising afterwards. After a few days, you’ll get the results of your prolactin test in the form of a number. The normal range for prolactin in your blood are: Males: 2 to 18 nanograms per milliliter (ng/mL) Nonpregnant females: 2 to 29 ng/mL Pregnant females: 10 to 209 ng/mL If Your Prolactin Levels Are High If your value falls outside the normal range, this doesn’t automatically mean you have a problem. Sometimes the levels can be higher if you’ve eaten or were under a lot of stress when you got your blood test. Also, what’s considered a normal range may be different depending on which lab your doctor uses. If your levels are very high -- up to 1,000 times the upper limit of what’s considered normal -- this could be a sign that you have prolactinoma. This tumor is not cancer, and it is usually treated with medicine. In this case, your doctor may want you to get an MRI. You’ll lie inside a magnetic tube as the MRI device uses radio waves to put together a detailed image of your brain. It will show whether there’s a mass near your pituitary gland and, if so, how big it is. If Your Levels Are Low If your prolactin levels are below the normal range, this could mean your pituitary gland isn’t working at full steam. That’s known as hypopituitarism. Lower levels of prolactin usually do not need medical treatment. Certain drugs can cause low levels of prolactin. They include: Dopamine (Intropin), which is given to people in shock Levodopa(for Parkinson’s disease) Ergot alkaloid derivatives(for severe headaches) Treatment Not all cases of high prolactin levels need to be treated. Your treatment will depend on the diagnosis. If it turns out to be a small prolactinoma or a cause can’t be found, your doctor may recommend no treatment at all. In some cases, your doctor may prescribe medicine to lower prolactin levels. If you have a prolactinoma, the goal is to use medicine to reduce the size of the tumor and lower the amount of prolactin. From https://www.webmd.com/a-to-z-guides/prolactin-test
  10. What Is the Role of “Growth Hormone” When You Have Stopped Growing? Growth hormone clearly plays a key role in development during youth, but research in adults implicates it as an agent in cellular aging processes. Shlomo Melmed, MD, ChB, the first recipient of the Transatlantic Alliance Award, co-sponsored by the Endocrine Society and the European Society of Endocrinology, discusses the misconceptions of administering growth hormone in adults. Children need growth hormone to grow into their adult height, but the hormone’s function among adults is unclear. The pituitary secretes less growth hormone as a person ages, but new research is elucidating a potentially important role for nonpituitary growth hormone generated in the periphery in regulating cellular proliferation associated with aging. AT A GLANCE Growth hormone levels decline with age — which may be a protective mechanism in slowing some of the effects of aging. Nonpituitary growth hormone in the colon epithelium has been shown to inhibit the tumor suppressor gene p53, resulting in pro-proliferative effects. Low levels of growth hormone in adulthood appear to be associated with greater longevity, whereas higher levels are associated with the adverse effects of aging. Unraveling the effects of this mysterious hormone has been a focus of the work of Shlomo Melmed, MB ChB, dean of the faculty of medicine at Cedars-Sinai in Los Angeles. Melmed is the inaugural winner of the Transatlantic Alliance Award, an honor co-sponsored by the Endocrine Society and the European Society of Endocrinology to recognize an international leader who has made significant advancements in endocrine research on both sides of the Atlantic. As part of the award, Melmed gave a presentation at both ENDO 2022 in Atlanta in June, and at the European Congress of Endocrinology 2022 in Milan entitled, “Growth Hormone: An Adult Endocrine Misnomer?” Dangers of Too Little or Too Much The growth hormone level declines dramatically with age such that it is barely detectable in the circulation by age 80, but even at low levels it is clearly playing an important role. “Adults deficient in pituitary growth hormone have a unique phenotype,” Melmed says. “They develop central obesity and may have high blood pressure and lethargy. Growth hormone in adulthood is needed to maintain body homeostasis, i.e., the appropriate ratio between lean body mass and fat mass. When these GH-deficient adults [receive] very low doses of growth hormone, body changes are recalibrated and homeostatic changes that occur with hormone deficiency may be reversed.” On the other hand, the deleterious effects of too much growth hormone from an over-secreting pituitary adenoma are well-known. “Patients with acromegaly have phenotypic features often associated with aging,” Melmed says. “They have heart disease, diabetes, hypertension, and osteoporosis, and may develop tumors. Many afflictions of aging are present, and the linkage of too much growth hormone with adverse effects on the aging process is clinically intuitive.” Nonpituitary Growth Hormone However, evidence is mounting that growth hormone that originates not from the pituitary but in the periphery could have significant effects. Melmed and others have been conducting cellular, animal, and human studies on the effects of autocrine and paracrine growth hormone. For example, the hormone appears to be produced by the epithelial cells of the colon and neighboring cells, where it acts locally to activate the growth hormone receptor, to engender cell cycle changes and DNA damage, and to promote pro-proliferative changes, Melmed says. One of its most important actions may be to inhibit the tumor suppressor gene p53, which is a powerful constraint on cell proliferation and tumor formation. “We found that growth hormone locally suppresses p53, thereby unleashing the cell to become more pro-proliferative,” Melmed says. “We performed a series of cellular and animal experiments to show that the molecular profile of aging may be accelerated by increasing growth hormone signaling, and if you block growth hormone action you may suppress deleterious aging effects on the cell cycle, including attenuation of DNA repair,” Melmed says. For example, their experiments showed that the drug pegvisomant, a growth hormone receptor inhibitor used to treat patients with acromegaly, can elevate p53 levels and enable a protective environment in the colon epithelium. “The role of growth hormone in regulating proliferation of colon cells could explain why patients with acromegaly have an abundance of colon polyps,” he tells Endocrine News. Evidence from Families Melmed says that other tantalizing clues implicating growth hormone in aging include the pioneering work of Endocrine Society Koch Awardee Anderzj Bartke, who showed that GH-deficient mice live longer. Furthermore, a Netherlands study of the relatives of centenarians found that these long-lived individuals and their family members have very low growth hormone levels. There have also been studies of several families around the world who have inactivating growth hormone receptor mutations with short stature and an extremely low incidence of cancer. “We re-introduced a normal growth hormone receptor into the mutated fibroblasts, and down-regulated their high p53 expression, another proof of principle in humans that local growth hormone may enable a pro-proliferative micro-environment,” Melmed says. “We propose, based upon the body of cellular, animal, and human data that have been generated by other colleagues and ourselves, that blocking growth hormone action may protect from adverse cellular effects of aging. We have no evidence that aging could be reversed, but blocking growth hormone signaling could mitigate pro-proliferative cell cycle events and DNA damage associated with aging,” Melmed says. “Adults deficient in pituitary growth hormone have a unique phenotype. They develop central obesity and may have high blood pressure and lethargy. Growth hormone in adulthood is needed to maintain body homeostasis, i.e., the appropriate ratio between lean body mass and fat mass. When these GH-deficient adults [receive] very low doses of growth hormone, body changes are recalibrated and homeostatic changes that occur with hormone deficiency may be reversed.” He notes that these findings have an immediate practical application as a counter to the large illicit market in which people, especially athletes, are taking growth hormone as a performance-enhancing drug “in an attempt to enhance athletic performance or to improve their longevity” when the evidence indicates that “the opposite is true, and growth hormone may in fact be harmful.” Seaborg is a freelance writer based in Charlottesville, Va. He wrote about the Endocrine Society’s latest Clinical Practice Guideline, “Management of Hyperglycemia in Hospitalized Adult Patients in Non-Critical Care Settings: An Endocrine Society Guideline,” in the July issue. From https://endocrinenews.endocrine.org/an-adult-endocrine-misnomer/?fbclid=IwAR0EIssqVRbv9SYloB5tHVIqIeQ6J7xjYYFgbszWVTX4eWS0uUWJShWPVKA
  11. Recordati's Isturisa is expected to launch in the second or third quarter. (Getty) As part of a small 2019 deal, Italian drugmaker Recordati snagged a trio of underperforming Novartis endocrinology meds, including a late-stage candidate for Cushing's disease. Less than a year later, that drug is cleared for market after an FDA green light. The FDA on Friday approved Recordati's Isturisa (osilodrostat) to treat Cushing's disease—a rare disease in which patients' adrenal glands produce too much cortisol—in those who have undergone a prior pituitary gland surgery or are not eligible for one. Isturisa, a cortisol synthesis inhibitor, will come with the FDA's orphan drug designation, providing market exclusivity for seven years, Recordati said (PDF) in a release. The drug is expected to be commercially available in the second or third quarter. The FDA based its review on phase 3 data showing 86% of patients treated with Isturisa showed normal cortisol levels in their urine after eight weeks, compared with 29% of patients treated with placebo, the drugmaker said. Recordati is "actively building its commercial, medical, and market access teams" to accommodate Isturisa's launch through its recently created U.S. endocrinology business unit, it said. The drugmaker will launch the drug with a "comprehensive distribution model" through specialty pharmacies. Novartis, once the owner of Isturisa, turned the asset over to Recordati in 2019 as part of a $390 million offload of some of the Swiss drugmaker's endocrinology portfolio. Recordati received Signifor, long-acting sister Signifor LAR and Isturisa, positioned as a successor drug to Signifor. The purchase included milestone payments tied to Isturisa. Recordati talked up the buy of the Cushing's disease trio as a boon for its rare disease portfolio, calling it a "key and historical milestone" at the time. From https://www.fiercepharma.com/pharma/recordati-scores-fda-nod-for-cushing-s-disease-med-isturisa
  12. Abstract Corticotroph macroadenomas are rare but difficult to manage intracranial neoplasms. Mutations in the two Cushing’s disease mutational hotspots USP8 and USP48 are less frequent in corticotroph macroadenomas and invasive tumors. There is evidence that TP53 mutations are not as rare as previously thought in these tumors. The aim of this study was to determine the prevalence of TP53 mutations in corticotroph tumors, with emphasis on macroadenomas, and their possible association with clinical and tumor characteristics. To this end, the entire TP53 coding region was sequenced in 86 functional corticotroph tumors (61 USP8 wild type; 66 macroadenomas) and the clinical characteristics of patients with TP53 mutant tumors were compared with TP53/USP8 wild type and USP8 mutant tumors. We found pathogenic TP53 variants in 9 corticotroph tumors (all macroadenomas and USP8 wild type). TP53 mutant tumors represented 14% of all functional corticotroph macroadenomas and 24% of all invasive tumors, were significantly larger and invasive, and had higher Ki67 indices and Knosp grades compared to wild type tumors. Patients with TP53 mutant tumors had undergone more therapeutic interventions, including radiation and bilateral adrenalectomy. In conclusion, pathogenic TP53 variants are more frequent than expected, representing a relevant amount of functional corticotroph macroadenomas and invasive tumors. TP53 mutations associated with more aggressive tumor features and difficult to manage disease. Introduction Pituitary neuroendocrine tumors are the second most common intracranial neoplasm [1]. They are usually benign, but when aggressive they may be particularly difficult to manage, accompanied by high comorbidity and increased mortality [2]. Corticotroph tumors constitute 6–10% of all pituitary tumors, but they represent up to 45% of aggressive pituitary tumors and pituitary carcinomas [2]. Functional corticotroph tumors cause Cushing’s disease (CD), a debilitating condition accompanied by increased morbidity and mortality due to glucocorticoid excess [3]. Pituitary surgery is the first line treatment, but recurrence is observed in 15–20% of cases of whom most are macroadenomas (with a size of ≥ 10 mm) [4]. Treatment options include repeated pituitary surgery, radiation therapy, medical treatment and bilateral adrenalectomy (BADX) [3]. With respect to the latter, corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome (CTP-BADX/NS) is a frequent severe complication and may present with aggressive tumor behavior [5,6,7]. Corticotroph tumors (including CTP-BADX/NS) carry recurrent somatic mutations in the USP8 gene in ~ 40–60% of cases [8,9,10,11,12,13]. These USP8 mutant tumors are usually found in female patients and are generally less invasive [8,9,10,11]. Additional genetic studies identified a second mutational hotspot in the USP48 gene, but no other driver mutations [14,15,16,17,18]. Focusing on USP8 wild type corticotroph tumors, we recently discovered TP53 mutations in 6 out of 18 cases (33%) [17]. Subsequent reports documented TP53 mutations in small series of mainly aggressive corticotroph tumors and carcinomas [19, 20]. TP53 is the most commonly mutated gene in malignant neoplasms [21, 22], including brain and neuroendocrine tumors [23, 24]. Until our previous report [17], TP53 mutations were only described in isolated cases of aggressive pituitary tumors and carcinomas, and were therefore considered very rare events [8, 16, 25,26,27,28]. A link between TP53 mutations and an aggressive corticotroph tumor phenotype has been hypothesized, but the heterogeneity and small size of the studies reported did not support significant clinical associations [17, 19]. To address this, we determined the prevalence of TP53 variants in a cohort of 86 patients with functional corticotroph tumors, including 61 with USP8 wild type tumors, and studied the associations between TP53 mutational status and clinical features. Methods Patients and samples We analyzed tumor samples of 86 adult patients: 61 USP8 wild type and 25 USP8 mutant. Sixty-six patients (46 females, 20 males) were diagnosed with CD between 1994 and 2020 in Germany (Hamburg, Munich, Erlangen, and Tübingen) and Luxembourg. Twenty additional patients (16 females, 4 males) were diagnosed with CTP-BADX/NS, operated and followed up in 7 different international centers (Nijmegen, Munich, Erlangen, Hamburg, Paris, Rio de Janeiro, and Würzburg). Twenty-three out of 86 samples were collected prospectively between 2018 and 2021, and 63 were retrospective cases (of which 42 were investigated in the context of USP8 and USP48 screenings and published elsewhere) [9, 12, 13, 17]. Seventy-one tumors were fresh frozen and 15 were formalin fixed paraffin embedded. Paired blood was available for 12 cases. The median follow-up time after initial diagnosis was 44 months (range 2–384 months). Endogenous Cushing’s syndrome was diagnosed according to typical clinical signs and symptoms and established biochemical procedures suggesting glucocorticoid excess. Clinical features included central obesity, moon face, buffalo hump, muscle weakness, easy bruising, striae, acne, low-impact bone fractures, mood changes, irregular menstruation, infertility and impotency. Biochemical diagnosis was based on increased 24 h urinary free cortisol (UFC) and late-night salivary cortisol levels, and lack of serum cortisol suppression after low-dose dexamethasone test. A pituitary ACTH source was confirmed by > 2.2 pmol/l (10 pg/ml) basal plasma ACTH, > 50% suppression of serum cortisol during an 8 mg dexamethasone test, and ACTH and cortisol response to corticotrophin releasing hormone stimulation. The clinical and pathological features of our study cohort are summarized in Additional file 1: Supplementary Table 1. All patients underwent pituitary surgery. The presence of an ACTH-producing pituitary tumor was confirmed histologically after surgical resection. Biochemical remission after surgery was defined as postoperative 24 h-UFC levels below or within the normal range, or serum cortisol levels < 5 µg/dl after low-dose (1 or 2 mg) dexamethasone suppression test. Tumor control was achieved when there was no evidence of regrowth or disease recurrence. Tumor invasion was defined as radiological or intraoperative evidence of tumor within the sphenoid and/or cavernous sinuses [29]. CTP-BADX/NS was defined as an expanding pituitary tumor after bilateral adrenalectomy (BADX) following expert consensus recommendations [5]. DNA extraction, TP53 amplification and sequencing Genomic DNA was extracted using the Maxwell Tissue DNA Kit (Promega), Maxwell Blood DNA kit (Promega) or the FFPE DNA mini kit (Qiagen), depending on the type of sample, as described previously [9, 12]. The entire coding sequence of TP53 (including exons 9β and 9γ) as well as noncoding regions adjacent to each exon were amplified using the GoTaq DNA polymerase (Promega) and specific primers (Additional file 1: Supplementary Table 2). Amplification of USP8 hotspot region and Sanger sequencing were performed as described previously [9, 12]. Chromatograms were analyzed using the Mutation Surveyor v4.0.9 (Soft Genetics). Samples were examined for TP53 coding and splicing variants. Variant position and pathogenicity was investigated in ENSEMBL (www.ensembl.org), the UCSC Genome Browser (http://genome-euro.ucsc.edu), the IARC TP53 database (https://p53.iarc.fr/TP53GeneVariations.aspx), the Catalogue Of Somatic Mutations in Cancer (COSMIC; https://cancer.sanger.ac.uk/cosmic), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), PHANTM (http://mutantp53.broadinstitute.org/), the Human Splicing Finder (HSF; http://www.umd.be/HSF3/) and VarSEAK splicing predictor (https://varseak.bio/). Variant frequencies on the general population were obtained from the Allele Frequency Aggregator (ALFA) project [30], the Genome Aggregation Database (gnomAD) [31] and the International Genome Sample Resource 1000Genome project [32]. Throughout the text, variants refer to NC_000017.11 (genomic DNA), ENST00000269305.9 (coding DNA) and ENSP00000269305.4 (protein), following the Human Genome Variation Society (HGVS) standard nomenclature system. Statistical analysis Statistical analysis was performed with the software package SPSS v24 (IBM). We used t-test or one-way ANOVA to analyze the association of TP53 variants with age, body mass index; Mann–Whitney U and Kruskal–Wallis to test non-parametric variables, such as tumor size, hormone levels, Ki67 index and p53 score. We corrected the analysis for multiple comparisons with the Bonferroni test. Categorical variables were analyzed using a chi-square test or Fisher exact test when needed. Survival analysis was performed using Kaplan–Meier curves with log-rank tests, and multivariate Cox regression. An exact, two-tailed significance level of P < 0.05 was considered to be statistically significant. Results Analysis of TP53 nucleotide variants We analyzed all TP53 coding exons (including exons 9β and 9γ) and adjacent intronic noncoding sequences in 61 USP8 wild type tumors (49 CD and 12 CTP-BADX/NS). Of these, 13 were microadenomas (< 10 mm) and 48 macroadenomas (≥ 10 mm) at the time of the current operation. A separate group of 25 USP8 mutant tumors (17 CD and 8 CTP-BADX/NS) that were mainly macroadenomas (n = 19) was used for multiple comparison. We found 59 variants in our cohort: 30 exclusively in USP8 wild type, 21 in USP8 mutant, and 8 in wild type and mutant tumors regardless of USP8 mutational status. No indels in the coding region of TP53 were detected. In addition, we did not find any genetic variant affecting TP53 splicing. Nine out of 30 variants found in USP8 wild type tumors were either reported in the COSMIC database as pathogenic or absent from the common variant databases (1000Genomes, gnomAD, ALPHA) or had allele frequency < 0.0001. They were all described in cancer series: 5 as pathogenic or likely pathogenic in ClinVar, 2 as variants of uncertain significance (VUS) and 2 were not described in ClinVar (Table 1). All variants are reported to alter protein function and show clear loss of transactivation activity in a yeast based assay (Table 1) [33]. Table 1 Functionally relevant TP53 variants found in 9/86 corticotroph tumors Full size table Seven variants target amino acids within the DNA-binding domain, essential for p53 activity, disrupting S2’ and S7 β-sheets or the L3 loop spatial conformation. The other two [c.1009C > G (p.Arg337Gly) and c.1031 T > C (p.Leu344Pro)] locate in the tetramerization domain and keep p53 protein as monomer impairing its transactivation activity [34]. From the 9 variants, 8 affect highly conserved p53 residues, while in c.1031 T > C (p.Met133Lys) the methionine alternates with leucine or valine among species. This variant alters protein folding, probably reducing DNA affinity [35], while the substitution of a methionine that acts as an alternative start codon abolishes the transcription of isoforms ∆133p53α, ∆133p53β and ∆133p53γ. The 9 variants were detected in nine cases (henceforth referred to as TP53 mutant; Table 1). Two tumors from unrelated patients (#6 and #7) carried the same variant c.818G > A (p.Arg273His), while one tumor (#4) carried two variants (c.718A > G and c.773A > C). Seven variants were found in heterozygosis, while the other two (from patients #1 and #2) in homozygosis. From these two, we only had paired blood/tumor samples from patient #1 and detected the variant only on the tumor sample, indicative of loss of heterozygosity (Additional file 1: Supplementary Fig. 1A). Similarly, we could demonstrate the somatic origin of the TP53 variants in four other patients with paired tumor/blood samples (#3, #5, #6 and #9). The remaining 21/30 variants found in USP8 wild type and all 21 variants found in the USP8 mutant tumors were described as benign, likely benign or VUS with no evidence of affecting protein function. All tumors with these variants were considered TP53 wild type. From the 21 variants found in the USP8 wild type tumors (henceforth referred to as TP53/USP8 wild type group), 7 were non-synonymous variants, 8 synonymous variants and 6 non-coding variants without splicing effect. From the 21 variants found in the 25 USP8 mutant tumors, nine were synonymous, four non-synonymous and eight non-coding without splicing effect. In addition, eight variants were found in tumors regardless of USP8 mutational status that were not categorized as TP53 mutations. The intronic variant c.782 + 62G > A was found in heterozygosis in 6/70 samples. It was not reported in any database and is not predicted to have any splicing effect. The remaining seven are common variants classified as benign or likely benign in ClinVar and their allele frequencies were similar to those reported for the general population (ALFA, gnomAD and 1000Genome project) (Additional file 1: Supplementary Table 3). Summarizing, all TP53 mutations were found in the USP8 wild type tumors, leading to a prevalence of 15% in this subgroup. Clinical presentation of patients with TP53 mutant tumors Patients with TP53 mutant tumors (n = 9) tended to be diagnosed at older age compared to TP53/USP8 wild type tumors (n = 52) (t-test P = 0.069; Table 2). This was significant after including the USP8 mutant group (n = 25) in the multiple comparison analysis (ANOVA P = 0.024, Table 2) and when TP53/USP8 wild type and USP8 mutant tumors were combined to a single group (TP53 wild type, n = 77; Additional file 1: Supplementary Table 4. We did not observe any sex specific predominance of TP53 mutations in contrast to USP8 mutants that are predominantly found in female patients. Furthermore, we did not find any statistically significant differences in ACTH and cortisol levels (Table2; Additional file 1: Supplementary Table 4). Table 2 Clinical features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups Full size table Patients with TP53 mutant tumors underwent more surgeries and tumor resection was more frequently incomplete compared to TP53/USP8 wild type (Table 2). These patients also underwent a higher number of additional therapeutic procedures (radiation, n = 7; BADX, n = 4; temozolomide, n = 3; pasireotide, n = 2). Only one patient (#4) with TP53 mutant tumor, a 77 year-old man, had a single surgery without any other treatment, but his follow-up was short (< 6 months). We observed TP53 mutations more frequently in CTP-BADX/NS (4/12, 33%) compared to CD (5/49, 10%), trending towards statistically significant difference (Fischer exact test P = 0.065 for TP53 mutant vs. TP53/USP8 wild type, P = 0.060 for comparison among the 3 groups; Table 2). The TP53 mutant group associated with higher disease-specific mortality and shorter survival than USP8 mutant or TP53/USP8 wild type groups (log rank test, P = 0.023, Fig. 1). Three patients with TP53 mutant tumors (all CTP-BADX/NS) died of disease-related deaths: two from severe cerebral hemorrhage after surgery and stereotactic radiation and one from uncontrolled disease after five failed operations, radiotherapy (gamma knife, fractionated radiation) and chemotherapy (temozolomide, bevacizumab) at the ages of 75, 80 and 37, respectively. Ten-year survival was 27% for patients with TP53 mutant tumors, 100% for TP53/USP8 wild type and 86% for USP8 mutant. In our cohort, survival did not differ after adjusting for age (HR 7.7, 95%CI 0.6–107.7, P = 0.127). Fig. 1 Kaplan–Meier curve showing overall survival in patients with TP53 mutant/USP8 wild type, USP8 mutant/TP53 wild type, and TP53 wild type/USP8 wild type corticotroph tumors. The table underneath the graph shows the 10-year cumulative survival after diagnosis Full size image Tumor samples from prior surgeries were available from one TP53 mutant case (#8, Table 1). This male patient had his first pituitary surgery for CD when he was 30 years old and was treated with γ-knife one year later. He then underwent two more pituitary surgeries and BADX until the age of 35. He developed CTP-BADX/NS with para- and retrosellar tumor extension along with panhypopituitarism and underwent two more pituitary surgeries before dying at the age of 38 due to complications of the disease. We detected the TP53 variant c.1009C > G (p.Arg337Gly) in all available tumor specimens, including his first and latest surgeries (Additional file 1: Supplementary Fig. 1B). No statistical association was found between clinical data and any of the 8 common variants. Characteristics of TP53 mutant corticotroph tumors All TP53 mutations were found in macroadenomas (9/66; Table 3). TP53 mutant tumors were larger that TP53/USP8 wild type (mm median [IQR] 20.0 [14.0] vs. 15.0 [14.3]), but this did not reach statistical significance (Table 3). Multiple comparison analysis showed that the difference in tumor size is significant only comparing TP53 mutant with USP8 mutant (median [IQR] 23.3 [14.0] vs. 14 [7.3] mm; Kruskal–Wallis P = 0.019; Bonferroni corrected P = 0.018). Table 3 Tumor features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups Full size table Parasellar invasion was reported in 34 out of 64 cases, for which this information was available, and it was more common in TP53 mutant tumors (100% vs. 53% and 55% for TP53/USP8 wild type and USP8 mutant, respectively; Fischer exact test P = 0.006). TP53 mutant tumors had higher Knosp grade (Kruskal–Wallis P = 0.011) with the majority being Knosp 4 (Table 3, Additional file 1: Supplementary Table 4). Ki67 proliferation index was available for 36 cases (6 TP53 mutant). Five out of six TP53 mutant tumors had Ki67 ≥ 3% and the overall Ki67 was higher than in the wild type tumors (Kruskal–Wallis P = 0.01; Bonferroni corrected P = 0.008 for TP53/USP8 wild type) (Table 3). Ki67 ≥ 10% was reported in 6 tumors, from which 5 were TP53 mutant (Fischer exact test P < 0.0001; the remaining case was TP53/USP8 wild type). We had information on p53 immunostaining from 9 cases (all macroadenomas), four of which TP53 mutant: 3 tumors (from patients #5, 6 and 9) showed high p53 immunoreactivity, while the one (from patient #3) carrying a nonsense variant leading to a truncated protein was p53 negative. The five TP53 wild type cases showed isolated nuclear staining in < 1–3% of cells. Summarizing, TP53 mutations were significantly associated with features related to a more aggressive tumor behavior, such as incomplete tumor resection, more frequent parasellar invasion, higher Knosp grade, and higher Ki67 proliferation index (Table 3; Additional file 1: Supplementary Table 4). Discussion Herein, we investigated the prevalence of TP53 mutations by screening a large cohort of 61 functional corticotroph tumors with USP8 wild type status, and found variants altering protein function in 15% of cases. We did not detect TP53 mutations in a separate group of 25 USP8 mutant tumors, which is in concordance with previously published small next-generation sequencing series [8, 18, 19]. Since we focused on USP8 wild type tumors, macroadenomas were overrepresented in our cohort. Consequently, it should be noted that the prevalence of TP53 mutations is expected to be lower in the general CD population. In fact, ~ 50% of corticotroph tumors carry USP8 mutations, which others and we have shown to be mutually exclusive. Corticotroph tumors with USP8 mutations are associated with female predominance, younger age at presentation, and less invasiveness (despite shorter time to relapse) [9, 11, 13, 18, 36]. In contrast, TP53 mutant tumors were diagnosed mostly at older age, did not show sex predominance and were larger and more invasive, with lower complete resection rate. None of the 19 microadenomas included in our study carried TP53 mutations. Still, we need to acknowledge that since no sample was microdissected we may have lost microadenoma cases with TP53 mutations. Instead, we found TP53 mutations in 9/66 macroadenomas (14%) and 8/34 (24%) invasive tumors, supporting the findings from smaller series [17, 19]. Tumor size at presentation or invasiveness do not reliably predict aggressiveness. Instead, the European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumors and carcinomas proposed a definition of pituitary tumor aggressiveness based on rapid or clinically relevant tumor growth despite optimal therapeutic options, along with bone invasion [37]. A recent study in a series of 9 aggressive pituitary tumors and carcinomas carrying ATRX mutations reported a high frequency of missense TP53 variants (5/9, 55.6%), further suggesting a link between TP53 mutational status and unfavorable outcome [20]. We do not have exact information on changes of tumor growth for the majority of our cases, but the higher number of surgical and radiation interventions, the higher Knosp grades, and the increased mortality rate indicate that patients with TP53 mutant tumors obviously follow a more aggressive disease course. Ki67 proliferation index together with p53 immunostaining and mitotic count have been suggested as histological markers of pituitary tumor aggressiveness [29, 38]. In our series, Ki67 was significantly higher in TP53 mutant tumors, reinforcing our prior observation of a higher proportion of TP53 mutant tumors in the Ki67 ≥ 3 group [17]. We had limited information on p53 immunohistochemistry, since this measure is not routinely performed in our collaborative centers. Nevertheless, in the few tumors with known p53 immunopositivity, it was higher in the TP53 mutant group, which is in concordance with a previous study reporting high p53 immunoreactivity in all TP53 mutant tumors [19]. A mutagenic action of radiation on TP53 has been hypothesized by small series on radiation-induced tumors. For instance, TP53 mutations were reported in 58% of radiation-induced sarcomas [39], while a meta-analysis reported TP53 mutations in 14/30 radiation-induced gliomas [40]. A previous study reported a case with frameshift TP53 mutation in the CTP-BADX/NS tumor, but not in the initial CD surgeries, and the mutation was therefore suspected to be induced by radiotherapy [41]. In our series, however, 4 out of 7 TP53 mutant tumors were obtained before radiation. In their case report, Pinto et al. suggested that TP53 mutations are acquired during tumorigenesis and condition tumor evolution [41]. In contrast, Casar-Borota et al. and Uzilov et al. reported high allele fraction of TP53 mutations, indicating that they are not a late event in corticotroph tumorigenesis [19, 20]. In addition, Uzilov et al. reported TP53 mutations in all tumor specimens from their two TP53 mutant cases with multiple surgeries [19]. Similarly, in our series we had tissue from multiple pituitary surgeries from one patient and found the TP53 variant in all samples (CD and CTP-BADX/NS), including specimens obtained before radiotherapy. Taken together, these observations suggest that in most cases, TP53 mutations may appear early during tumor development. A limitation of our study is the short follow-up of patients who were prospectively included. Moreover, material from repeated surgeries was lacking from most patients with TP53 mutant tumors, hampering the examination of tumor evolution in these patients. Similarly, we had limited access to blood samples, so we could not demonstrate the somatic origin for all variants. Nevertheless, the older age at initial diagnosis of CD in patients with TP53 mutant tumors (53 ± 19.5 years old, with the youngest patient diagnosed at the age of 30) and the absence of additional neoplasias during follow-up also support a somatic instead of a germline origin. Furthermore, conditions related to germline TP53 mutations, such as Li-Fraumeni syndrome, very rarely present with pituitary tumor [42]. To our knowledge, the only published case so far was a pediatric patient with an aggressive lactotroph tumor [43]. In addition to the TP53 mutations, we detected several common variants. Variants rs59758982 and rs1042522 have been associated with increased cancer susceptibility [44, 45]. In some cancer types, the very frequent rs1042522 c.215G > C (p.Pro72Arg) alternative variant correlated to more efficient induction of apoptosis by DNA-damaging chemotherapeutic drugs, growth suppression and higher metastatic potential [46,47,48]. In nonfunctioning pituitary tumors, alternative allele C (leading to p.Arg72) was related to early age at presentation and reduced p21 expression [49]. Very recently, an overrepresentation of the rs1042522 alternative allele C (p.Arg72) was reported in 9 out of 10 corticotroph neoplasias including 5 functional tumors (allele frequency 0.900, vs 0.714 in Latino/admixed American in gnomAD [31]) without any association with clinical features [50]. In our cohort, we did not detect different allele frequencies in any of the investigated common variants (including rs1042522) compared with public databases, nor statistical association with any clinical variable, rendering their contribution to corticotroph pathophysiology unlikely. Conclusion Screening a large corticotroph tumor series revealed that TP53 mutations are more frequent than previously considered. Furthermore, we show that patients with TP53 mutant tumors had higher number of surgeries, more invasive tumors, and worse disease outcome. Our study provides evidence that patients with pathogenic or function altering variants may require more intense treatment and extended follow-up, and suggests screening for TP53 variants in macroadenomas with wild type USP8 status. Further work is needed to determine the potential use of TP53 status as a predictor of disease outcome. Availability of data and materials The authors declare that the relevant data supporting the conclusions of this article are included within the article and its supplementary information file. Additional clinical data are available from the corresponding authors MT and LGPR upon reasonable request. Abbreviations CD: Cushing’s disease BADX: Bilateral adrenalectomy CTP-BADX/NS: Corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome ACTH: Adrenocorticotropic hormone SD: Standard deviation IQR: Interquartile range HR: Hazard ratio References Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS (2018) CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011–2015. Neuro Oncol 20:iv1-86 PubMed PubMed Central Article Google Scholar McCormack A, Dekkers OM, Petersenn S, Popovic V, Trouillas J, Raverot G et al (2018) Treatment of aggressive pituitary tumours and carcinomas: results of a European society of endocrinology (ESE) survey 2016. Eur J Endocrinol 178:265–276 CAS PubMed Article Google Scholar Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR et al (2021) Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol 9:847–875 PubMed Article Google Scholar Dimopoulou C, Schopohl J, Rachinger W, Buchfelder M, Honegger J, Reincke M et al (2013) Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: care reality in the Munich metropolitan region. Eur J Endocrinol 170:283–292 PubMed Article CAS Google Scholar Reincke M, Albani A, Assie G, Bancos I, Brue T, Buchfelder M et al (2021) Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): systematic review and expert consensus recommendations. Eur J Endocrinol 184:P1-16 CAS PubMed PubMed Central Article Google Scholar Fountas A, Lim ES, Drake WM, Powlson AS, Gurnell M, Martin NM et al (2020) Outcomes of patients with Nelson’s syndrome after primary treatment: a multicenter study from 13 UK pituitary centers. J Clin Endocrinol Metab 105:1527–1537 Article Google Scholar Kemink SA, Wesseling P, Pieters GF, Verhofstad AA, Hermus AR, Smals AG (1999) Progression of a Nelson’s adenoma to pituitary carcinoma; a case report and review of the literature. J Endocrinol Invest 22:70–75 CAS PubMed Article Google Scholar Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F et al (2015) Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet 47:31–38 CAS PubMed Article Google Scholar Pérez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA et al (2015) The Gene of the ubiquitin-specific protease 8 is frequently mutated in adenomas causing Cushing’s disease. J Clin Endocrinol Metab 100:E997-1004 PubMed PubMed Central Article Google Scholar Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F et al (2015) Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res 25:306–317 CAS PubMed PubMed Central Article Google Scholar Hayashi K, Inoshita N, Kawaguchi K, Ardisasmita AI, Suzuki H, Fukuhara N et al (2016) The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol 174:213–226 CAS PubMed Article Google Scholar Pérez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferraù F et al (2018) Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol 178:59–65 Article Google Scholar Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S et al (2018) The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf) 89:454–458 CAS Article Google Scholar Bi WL, Horowitz P, Greenwald NF, Abedalthagafi M, Agarwalla PK, Gibson WJ et al (2017) Landscape of genomic alterations in pituitary adenomas. Clin Cancer Res 23:1841–1851 CAS PubMed Article Google Scholar Song Z-J, Reitman ZJ, Ma Z-Y, Chen J-H, Zhang Q-L, Shou X-F et al (2016) The genome-wide mutational landscape of pituitary adenomas. Cell Res 26:1255–1259 CAS PubMed PubMed Central Article Google Scholar Chen J, Jian X, Deng S, Ma Z, Shou X, Shen Y et al (2018) Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat Commun 9:3171 PubMed PubMed Central Article CAS Google Scholar Sbiera S, Perez-Rivas LG, Taranets L, Weigand I, Flitsch J, Graf E et al (2019) Driver mutations in USP8 wild-type Cushing’s disease. Neuro Oncol 21:1273–1283 CAS PubMed PubMed Central Article Google Scholar Neou M, Villa C, Armignacco R, Jouinot A, Raffin-Sanson ML, Septier A et al (2020) Pangenomic classification of pituitary neuroendocrine tumors. Cancer Cell 37:123-134.e5 CAS PubMed Article Google Scholar Uzilov AV, Taik P, Cheesman KC, Javanmard P, Ying K, Roehnelt A et al (2021) USP8 and TP53 drivers are associated with CNV in a corticotroph adenoma cohort enriched for aggressive tumors. J Clin Endocrinol Metab 106:826–842 PubMed Article Google Scholar Casar-Borota O, Boldt HB, Engström BE, Andersen MS, Baussart B, Bengtsson D et al (2021) Corticotroph aggressive pituitary tumors and carcinomas frequently harbor ATRX mutations. J Clin Endocrinol Metab 106:1183–1194 PubMed Article Google Scholar Campbell PJ, Getz G, Korbel JO, Stuart JM, Jennings JL, Stein LD et al (2020) Pan-cancer analysis of whole genomes. Nature 578:82–93 Article CAS Google Scholar Bouaoun L, Sonkin D, Ardin M, Hollstein M, Byrnes G, Zavadil J et al (2016) TP53 variations in human cancers: new lessons from the IARC TP53 database and genomics data. Hum Mutat 37:865–876 CAS PubMed Article Google Scholar Horbinski C, Ligon KL, Brastianos P, Huse JT, Venere M, Chang S et al (2019) The medical necessity of advanced molecular testing in the diagnosis and treatment of brain tumor patients. Neuro Oncol 21:1498–1508 CAS PubMed PubMed Central Article Google Scholar van Riet J, van de Werken HJG, Cuppen E, Eskens FALM, Tesselaar M, van Veenendaal LM et al (2021) The genomic landscape of 85 advanced neuroendocrine neoplasms reveals subtype-heterogeneity and potential therapeutic targets. Nat Commun 12:4612 PubMed PubMed Central Article CAS Google Scholar Herman V, Drazin NZ, Gonsky R, Melmed S (1993) Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab 77:50–55 CAS PubMed Google Scholar Levy A, Hall L, Yeudall WA, Lightman SL (1994) p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf) 41:809–814 CAS Article Google Scholar Tanizaki Y, Jin L, Scheithauer BW, Kovacs K, Roncaroli F, Lloyd RV (2007) P53 gene mutations in pituitary carcinomas. Endocr Pathol 18:217–222 CAS PubMed Article Google Scholar Kawashima ST, Usui T, Sano T, Iogawa H, Hagiwara H, Tamanaha T et al (2009) P53 gene mutation in an atypical corticotroph adenoma with Cushing’s disease. Clin Endocrinol (Oxf) 2009:656–657 Article Google Scholar Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G et al (2013) A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol 126:123–135 PubMed Article Google Scholar Phan J, Jin Y, Zhang H, Qiang W, Shekhtman E, Shao D et al (2020) ALFA: allele frequency aggregator: national center for biotechnology information, U.S. National Library of Medicine. Available from www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa/ Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alföldi J, Wang Q et al (2020) The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581:434–443 CAS PubMed PubMed Central Article Google Scholar Fairley S, Lowy-Gallego E, Perry E, Flicek P (2020) The International genome sample resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res 48:D941–D947 CAS PubMed Article Google Scholar Kato S, Han S-Y, Liu W, Otsuka K, Shibata H, Kanamaru R et al (2003) Understanding the function–structure and function–mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci 100:8424–8429 CAS PubMed PubMed Central Article Google Scholar Kawaguchi T, Kato S, Otsuka K, Watanabe G, Kumabe T, Tominaga T et al (2005) The relationship among p53 oligomer formation, structure and transcriptional activity using a comprehensive missense mutation library. Oncogene 24:6976–6981 CAS PubMed Article Google Scholar Greenblatt MS, Chappuis PO, Bond JP, Hamel N, Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61:4092–4097 CAS PubMed Google Scholar Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D et al (2020) Ubiquitin-Specific Protease 8 mutant corticotrope adenomas present unique secretory and molecular features and shed light on the role of ubiquitylation on ACTH processing. Neuroendocrinology 110:119–129 CAS PubMed Article Google Scholar Raverot G, Burman P, McCormack A, Heaney A, Petersenn S, Popovic V et al (2018) European society of endocrinology clinical practice guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 178:G1-24 CAS PubMed Article Google Scholar Thapar K, Scheithauer BW, Kovacs K, Pernicone PJ, Laws ER (1996) p53 expression in pituitary adenomas and carcinomas: correlation with invasiveness and tumor growth fractions. Neurosurgery 38:765–70 CAS PubMed Article Google Scholar Gonin-Laurent N, Gibaud A, Huygue M, Lefèvre SH, Le Bras M, Chauveinc L et al (2006) Specific TP53 mutation pattern in radiation-induced sarcomas. Carcinogenesis 27:1266–1272 CAS PubMed Article Google Scholar Whitehouse JP, Howlett M, Federico A, Kool M, Endersby R, Gottardo NG (2021) Defining the molecular features of radiation-induced glioma: a systematic review and meta-analysis. Neuro-Oncol Adv 3:1–16 Google Scholar Pinto EM, Siqueira SACC, Cukier P, Fragoso MCBVCBV, Lin CJ, De Mendonca BB et al (2011) Possible role of a radiation-induced p53 mutation in a Nelson’s syndrome patient with a fatal outcome. Pituitary 14:400–404 PubMed Article Google Scholar Orr BA, Clay MR, Pinto EM, Kesserwan C (2020) An update on the central nervous system manifestations of Li–Fraumeni syndrome. Acta Neuropathol 139:669–87 CAS PubMed Article Google Scholar Birk H, Kandregula S, Cuevas-Ocampo A, Wang CJ, Kosty J, Notarianni C (2022) Pediatric pituitary adenoma and medulloblastoma in the setting of p53 mutation: case report and review of the literature. Childs Nerv Syst. https://doi.org/10.1007/s00381-022-05478-8 Article Google Scholar Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS (2004) Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 210:151–157 CAS PubMed Article Google Scholar Sagne C, Marcel V, Amadou A, Hainaut P, Olivier M, Hall J (2013) A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): geographic and tumor-specific effects. Cell Death Dis 4:e492 CAS PubMed PubMed Central Article Google Scholar Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H et al (2009) Prognostic significance of p53 Codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clin Cancer Res 15:2406–2416 CAS PubMed PubMed Central Article Google Scholar Dumont P, Leu JIJ, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33:357–365 CAS PubMed Article Google Scholar Basu S, Gnanapradeepan K, Barnoud T, Kung CP, Tavecchio M, Scott J et al (2018) Mutant p53 controls tumor metabolism and metastasis by regulating PGC-1α. Genes Dev 32:230–243 CAS PubMed PubMed Central Article Google Scholar Yagnik G, Jahangiri A, Chen R, Wagner JR, Aghi MK (2017) Role of a p53 polymorphism in the development of nonfunctional pituitary adenomas. Mol Cell Endocrinol 446:81–90 CAS PubMed PubMed Central Article Google Scholar Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I et al (2022) The genomic landscape of corticotroph tumors: from silent adenomas to ACTH-secreting carcinomas. Int J Mol Sci. 23:4861 CAS PubMed PubMed Central Article Google Scholar Download references Funding Open Access funding enabled and organized by Projekt DEAL. The study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Project number: 314061271-TRR 205 to MF, MR and MT; FA 466/5-1 to MF; DE 2657/1-1 to TD), Metiphys program of the LMU Medical Faculty (to AA), Else Kröner-Fresenius Stiftung (Project number: 2012_A103 and 2015_A228 to MR) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; Project number: E-26/211.294/2021 to MRG). Author information Authors and Affiliations Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, Germany Luis Gustavo Perez-Rivas, Julia Simon, Adriana Albani, Sicheng Tang, Günter K. Stalla, Martin Reincke & Marily Theodoropoulou Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, Munich, Germany Sigrun Roeber & Jochen Herms Department of Endocrinology, Center for Rare Adrenal Diseases, Assistance Publique-Hôpitaux de Paris, Hôpital Cochin, Paris, France Guillaume Assié Université de Paris, Institut Cochin, Inserm U1016, CNRS UMR8104, F-75014, Paris, France Guillaume Assié Division of Endocrinology and Diabetes, Department of Internal Medicine I, University Hospital, University of Würzburg, Würzburg, Germany Timo Deutschbein & Martin Fassnacht Medicover Oldenburg MVZ, Oldenburg, Germany Timo Deutschbein Division of Endocrinology, Hospital Universitário Clementino Fraga Filho, Rio de Janeiro, Brazil Monica R. Gadelha Division of Endocrinology, Department of Internal Medicine, Radboud University Medical Centre, Nijmegen, The Netherlands Ad R. Hermus Medicover Neuroendocrinology, Munich, Germany Günter K. Stalla Service d’Endocrinologie, Centre Hospitalier du Nord, Ettelbruck, Luxembourg Maria A. Tichomirowa Department of Neurosurgery, Universitätskrankenhaus Hamburg-Eppendorf, Hamburg, Germany Roman Rotermund & Jörg Flitsch Department of Neurosurgery, University of Erlangen-Nürnberg, Erlangen, Germany Michael Buchfelder Department of Neurosurgery, University of Tübingen, Tübingen, Germany Isabella Nasi-Kordhishti & Jürgen Honegger Neurochirurgische Klinik und Poliklinik, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, Germany Jun Thorsteinsdottir Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany Wolfgang Saeger Contributions LPGR and MT designed the study. LPGR, JS, AA and ST implemented the study. LGPR did the data analysis. SR, GA, TD, MF, MRG, ARH, GKS, MAT, RR, JF, MB, INK, JH, JT, WS, JH and MR provided patient materials and data. LGPR and MT interpreted the data and composed the main draft of the manuscript. All authors have seen, corrected and approved the final draft. Corresponding authors Correspondence to Luis Gustavo Perez-Rivas or Marily Theodoropoulou. Ethics declarations Ethics approval and consent to participate The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of the LMU Munich (Nr. 643-16). All patients provided written informed consent. Competing interests The authors declare that they have no competing interests. Additional information Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Supplementary Information Additional file 1 of TP53 mutations in functional corticotroph tumors are linked to invasion and worse clinical outcome Skip to file navigationSkip to generic navigation 1 Supplementary Table 1 . Description of study cohort. Variable mean/median SD/IQR Total n Age at diagnosis (years), mean ±SD, [total n] 42 ±15.2 86 Sex (female), n (%), [total n] 62 (72%) 86 BMI (kg/m2), mean ±SD, [total n] 28.9 ±6.3 74 Disease presentation, n (%), [total n] 86 Cushing 66 (77%) Nelson 20 (23%) Number of prior pituitary surgeries, n (%), [total n] 80 0 50 (63%) 1 23 (29%) ≥2 7 (9%) Total number of pituitary surgeries, n (%), [total n] 82 1 46 (56%) 2 23 (28%) ≥3 13 (16%) Complete tumor resection, n (%), [total n] 32 (60%) 53 Postoperative remission, n (%), [total n] 46 (59%) 78 Postoperative tumor control, n (%), [total n] 34 (60%) 57 Radiation therapy, n (%), [total n] 24 (34%) 70 Radiation therapy before sample collection, n (%), [total n] 7 (13%) 53 Bilateral adrenalectomy, n (%), [total n] 23 (27%) 86 Pharmacological treatments a , n (%), [total n] 18 (42%) 43 Preoperative hormone levels Plasma ACTH (pg/mL), median (IQR) 98 (570.4) 75 Serum cortisol ( μ g/dl), median (range) 29.1 (168.6) 50 24h - urinary free cortisol ( μ g/24h), median (range) 432.5 (598.3) 30 Serum cortisol after low - dose DST ( μ g/dl), median (IQR) 20 (20.7) 46 Postoperative hormone levels Plasma ACTH (pg/mL), median (IQR) 20 (107.6) 57 Serum cortisol nadir ( μ g/dl), median (range) 8.8 (19.4) 58 Tumo r size (mm), median (IQR), [total n] 15 (13.0) 85 Microadenoma 19 (22%) Macroadenoma 66 (78%) Granulation, n (%), [total n] 30 Sparsely 9 (30%) Densely 21 (70%) Ki67 index, median (IQR), [total n] 2.0 (3.8) 36 Ki67 index ≥3%, n (%) 14 (39%) 36 p53 positivity, median (IQR), [total n] 1 (26.5) 9 Invasion, n (%), [total n] 34 (53%) 64 Hardy grade, n (%), [total n] 61 1 13 (21%) 2 22 (36%) 3 18 (30%) 4 8 (13%) Knosp grade, n (%), [total n] 35 0 5 (14%) 1 12 (34%) 2 3 (9%) 3 7 (20%) 4 8 (7%) Disease - specific death, n (%), [total n] 5 (9%) 58 a Pharmacological treatments: pasireotide (n=6), ketoconazole (n=5), mitotane (n=5), temozolamide (n=4) metyrapone (n=5), cabergoline (n=3), bevazizumab (n=1). Five patients received >1 pharmacological agent. 2 Supplementary Table 2 . Primers used for TP53 amplification and Sanger sequencing. Primer Sequence DNA source TP53 - 1 5' - TCTCATGCTGGATCCCCACT - 3' FF, FFPE TP53 - 1rv 5' - GACCAGGTCCTCAGCC - 3' FFPE TP53 - 2fw 5' - GGGGGCTGAGGACCTGGT - 3' FFPE TP53 - 2rv 5' - ATACGGCCAGGCATTGAAGT - 3' FFPE TP53 - 2 5' - AGAGGAATCCCAAAGTTCCA - 3' FF TP53 - 3 5' - GTGCCCTGACTTTCAACTC - 3' FF, FFPE TP53 - 3rv 5' - GGCAACCAGCCCTGTC - 3' FFPE TP53 - 4fw 5' - GCCTCTGATTCCTCACTGAT - 3' FFPE TP53 - 4 5' - CAGGAGAAAGCCCCCCTACT - 3' FF, FFPE TP53 - 5 5' - CTTGCCACAGGTCTCCCCAA - 3' FF, FFPE TP53 - 6 5' - AGGGGTCAGAGGCAAGCAGA - 3' FF, FFPE TP53 - 7 5' - TAGGACCTGATTTCCTTA - 3' FF, FFPE TP53 - 7rv 5' - AGTGAATCTGAGGCATAAC - 3' FFPE TP53 - 7Bfw 5' - TGGAGGAGACCAAGGGTG - 3' FFPE TP53 - 7Brv 5' - CGGCATTTTGAGTGTTAGAC - 3' FFPE TP53 - 8 5' - TAAGCTATGATGTTCCTTAG - 3' FF, FFPE TP53 - 8rv 5' - GACTGTTTTACCTGCAATTG - 3' FFPE TP53 - 9 5' - CAATTGTAACTTGAACCATC - 3' FF, FFPE TP53 - 10 5' - GGATGAGAATGGAATCCTAT - 3' FF, FFPE TP53 - 11 5' - TCTCACTCATGTGATGTCATC - 3' FF, FFPE TP53 - 12 5' - CACACCTATTGCAAGCAAGG - 3' FF, FFPE FF, fresh frozen; FFPE, formalin - fixed paraffin embedded. figshare Download Additional file 1 Additional file 1. Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS. Additional file 1 . Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS. Rights and permissions Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Reprints and Permissions From https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-022-01437-1#Abs1
  13. More than 80% of adults with Cushing’s disease receiving osilodrostat had normalized mean urinary free cortisol levels at 72 weeks of treatment, according to findings from the LINC 3 study extension. “Cushing’s disease is a chronic condition, and many patients require prolonged pharmacological treatment. Therefore, evaluating long-term efficacy and safety of drug therapies in clinical trials is essential,” Maria Fleseriu, MD, FACE, professor of medicine and neurological surgery and director of the Pituitary Center at Oregon Health & Science University in Portland and a Healio | Endocrine Today co-editor, told Healio. “Our findings build on the positive results of the LINC 3 study core phase, and it was reassuring to see that continued treatment with osilodrostat for over 72 weeks provided long-term normalization of cortisol levels. Furthermore, continued treatment with osilodrostat also led to sustained improvements in clinical signs and physical manifestations of hypercortisolism, as well as health-related quality of life, which are all important factors in the management of these patients.” Fleseriu and colleagues enrolled 106 adults with Cushing’s disease who were responders to osilodrostat (Isturisa, Recordati) at 48 weeks during the LINC 3 core study to enter the extension phase of the trial. Participants continued to receive open-label osilodrostat until 72 weeks or treatment discontinuation. Mean urinary free cortisol was collected every 12 weeks. Physical manifestations of hypercortisolism were rated at 48 and 72 weeks. Participants completed the Cushing’s Quality of Life questionnaire and Beck Depression Inventory II at 48 and 72 weeks. Adults were deemed to have completely responded to treatment if mean urinary free cortisol was less than the upper limit of normal and partially responded to treatment if mean urinary free cortisol was above the upper limit of normal but decreased more than 50% from baseline. The findings were published in the European Journal of Endocrinology. Of the 106 participants in the extension study, 98 completed 72 weeks of treatment. At 72 weeks, 81.1% of participants were complete responders to treatment, and reductions in mean urinary free cortisol from the core phase were maintained during the extension. Improvements in most cardiovascular and metabolic-related parameters from the core study were maintained or improved in the extension phase. The cohort also had increases in quality of life score and improvements in Beck Depression Inventory II scores. The proportion of participants with improvements in physical manifestation of hypercortisolism were maintained or improved in all areas at 72 weeks. For hirsutism in women, 86.4% had an improved or stable severe score at 72 weeks. Improved scores were observed in participants with mild, moderate and severe physical manifestations at baseline with few adults experiencing worse manifestations at the end of the extension study. There were no new safety signals reported in the extension study. Of the extension study participants, 11.3% discontinued osilodrostat due to adverse events, a similar percentage to the 10.9% discontinuation rate during the core phase of the study. Several hormone concentrations, including mean adrenocorticotropic hormone, 11-deoxycortisol and plasma aldosterone, stabilized during the extension phase after changes were observed in the core study compared with baseline. Mean testosterone in women decreased from 2.6 nmol/L at 48 weeks to 2.1 nmol/L at 72 weeks. There were no changes observed in mean testosterone levels for men. “Patients should be regularly monitored and osilodrostat dose titrated as necessary, alongside adjustment of concomitant medications, to optimize outcomes,” the researchers wrote. “Taken together, these findings support osilodrostat as an effective and well-tolerated long-term treatment option for patients with Cushing’s disease.” For more information: Maria Fleseriu, MD, FACE, can be reached at fleseriu@ohsu.edu. From https://www.healio.com/news/endocrinology/20220914/osilodrostat-normalizes-urinary-free-cortisol-in-cushings-disease-for-most-at-72-weeks
  14. Cortisol isn’t bad; you need it to help regulate your responses to life. Regulation involves a very complex interplay of feedback loops between the hypothalamus, pituitary gland, and adrenal glands, says Dr. Singh. “In general, cortisol levels tend to peak in the late morning and gradually decline throughout the day,” he explains. “When a stressful event occurs, the increased cortisol will work alongside our ‘fight or flight’ mechanisms to either upregulate or downregulate bodily functions. [Affected systems include] the central nervous system, cardiovascular system, gastrointestinal system, or immune system.” In addition to normal processes that trigger or suppress cortisol release, levels can also be affected by different medical conditions, Dr. Singh says. For example, if someone has abnormally high levels of cortisol, this is called Cushing’s syndrome, which is typically caused by a tumor affecting any of the glands that take part in the process of cortisol production. When people suffer from abnormally low levels of cortisol, it’s called Addison’s disease. It generally occurs due to adrenal gland dysfunction, but could also be the result of abnormal functioning of any of the other glands in the cortisol production process. Finally, if you use corticosteroid medications such as prednisone or dexamethasone, prolonged use will result in excessive cortisol production, Dr. Singh says. “If the medication is not adequately tapered down when discontinued, the body’s ability to create cortisol can become permanently impaired,” he says. From https://www.yahoo.com/lifestyle/manage-pesky-stress-hormone-cortisol-184900397.html
  15. Abstract Background. Cushing’s disease (CD) recurrence in pregnancy is thought to be associated with estradiol fluctuations during gestation. CD recurrence in the immediate postpartum period in a patient with a documented dormant disease during pregnancy has never been reported. Case Report. A 30-year-old woman with CD had improvement of her symptoms after transsphenoidal resection (TSA) of her pituitary lesion. She conceived unexpectedly 3 months postsurgery and had no symptoms or biochemical evidence of recurrence during pregnancy. After delivering a healthy boy, she developed CD 4 weeks postpartum and underwent a repeat TSA. Despite repeat TSA, she continued to have elevated cortisol levels that were not well controlled with medical management. She eventually had a bilateral adrenalectomy. Discussion. CD recurrence may be higher in the peripartum period, but the link between pregnancy and CD recurrence and/or persistence is not well studied. Potential mechanisms of CD recurrence in the postpartum period are discussed below. Conclusion. We describe the first report of recurrent CD that was quiescent during pregnancy and diagnosed in the immediate postpartum period. Understanding the risk and mechanisms of CD recurrence in pregnancy allows us to counsel these otherwise healthy, reproductive-age women in the context of additional family planning. 1. Introduction Despite a relatively high prevalence of Cushing’s syndrome (CS) in women of reproductive age, it is rare for pregnancy to occur in patients with active disease [1]. Hypercortisolism leads to infertility through impairment of the hypothalamic gonadal axis. Additionally, while Cushing’s disease (CD) is the leading etiology of CS in nonpregnant adults, it is less common in pregnancy, accounting for only 30–40% of the CS cases in pregnant women [2]. It has been suggested that in CD there is hypersecretion of both cortisol and androgens, impairing fertility to a greater extent, while in CS of an adrenal origin, hypersecretion is almost exclusively of cortisol with minimal androgen production [3]. Regardless of the cause, active CS in pregnancy is associated with a higher maternal and fetal morbidity, hence, prompt diagnosis and treatment are essential. Pregnancy is considered a physiological state of hypercortisolism, and the peripartum period is a common time for women to develop CD [3, 4]. A recent study reported that 27% of reproductive-age women with CD had onset associated with pregnancy [4]. The high rate of pregnancy-associated CD suggests that the stress of pregnancy and peripartum pituitary corticotroph hyperstimulation may promote or accelerate pituitary tumorigenesis [4–6]. During pregnancy, the circulating levels of corticotropin-releasing hormone (CRH) in the plasma increase exponentially as a result of CRH production by the placenta, decidua, and fetal membranes rather than by the hypothalamus. Unbound circulating placental CRH stimulates pituitary ACTH secretion and causes maternal plasma ACTH levels to rise [4]. A review of the literature reveals many studies of CD onset during the peripartum period, but CD recurrence in the peripartum period has only been reported a handful of times [7–10]. Of these, most cases recurred during pregnancy. CD recurrence in the immediate postpartum period has only been reported once [7]. Below, we report for the first time a case of CD recurrence that occurred 4 weeks postpartum, with a documented dormant disease throughout pregnancy. 2. Case Presentation A 30-year-old woman initially presented with prediabetes, weight gain, dorsal hump, abdominal striae, depression, lower extremity weakness, and oligomenorrhea with a recent miscarriage 10 months ago. Diagnostic tests were consistent with CD. Results included the following: three elevated midnight salivary cortisols: 0.33, 1.38, and 1.10 μg/dL (<0.010–0.090); 1 mg dexamethasone suppression test (DST) with cortisol 14 μg/dL (<1.8); elevated 24 hr urine cortisol (UFC) measuring 825 μg/24 hr (6–42); ACTH 35 pg/mL (7.2–63.3). MRI of the pituitary gland revealed a left 4 mm focal lesion (Figure 1(a)). After transsphenoidal resection (TSA), day 1, 2, and 3 morning cortisol values were 18, 5, and 2 μg/dL, respectively. Pathology did not show a definitive pituitary neoplasm. She was rapidly titrated off hydrocortisone (HC) by six weeks postresection. Her symptoms steadily improved, including improved energy levels, improved mood, and resolution of striae. She resumed normal menses and conceived unexpectedly around 3 months post-TSA. Hormonal evaluation completed a few weeks prior to her pregnancy indicated no recurrence: morning ACTH level, 27.8 pg/mL; UFC, 5 μg/24 hr; midnight salivary cortisol, 0.085 and 0.014 μg/dL. Her postop MRI at that time did not show a definitive adenoma (Figure 1(b)). During pregnancy, she had a normal oral glucose tolerance test at 20 weeks and no other sequela of CD. Every 8 weeks, she had 24-hour urine cortisol measurements. Of these, the highest was 93 μg/24 hr at 17 weeks and none were in the range of CD (Table 1). Towards the end of her 2nd trimester, she started to complain of severe fatigue. Given her low 24 hr urine cortisol level of 15 μg/24 hr at 36 weeks gestation, she was started on HC. She underwent a cesarean section at 40 weeks gestation for oligohydramnios and she subsequently delivered a healthy baby boy weighing 7.6 pounds with APGAR scores at 1 and 5 minutes being 9 and 9. HC was discontinued immediately after delivery. Around four weeks postpartum she developed symptoms suggestive for CD. Diagnostic tests showed an elevated midnight salivary cortisol of 0.206 and 0.723 μg/dL, and 24-hour urine cortisol of 400 μg/24 hr. MRI pituitary illustrated a 3 mm adenoma in the left posterior region of the gland, which was thought to represent a recurrent tumor (Figure 1(c)). A discrete lesion was found and resected during repeat TSA. Pathology confirmed corticotroph adenoma with MIB-1 < 3%. On postoperative days 1, 2, and 3, the cortisol levels were 26, 10, and 2.8 μg/dL, respectively. She was tapered off HC within one month. Her symptoms improved only slightly and she continued to report weight gain, muscle weakness, and fatigue. Three months after repeat TSA, biochemical data showed 1 out of 2 midnight salivary cortisols elevated at 0.124 μg/dL and elevated urine cortisol of 76 μg/24 hr. MRI pituitary demonstrated a 3 × 5 mm left enhancement, concerning for residual or enlarged persistent tumor. Subsequent lab work continued to show a biochemical excess of cortisol, and the patient was started on metyrapone but reported no significant improvement of her symptoms and only mild improvement of excess cortisol. After a multidisciplinary discussion, the patient made the decision to pursue bilateral adrenalectomy, as she refused further medical management and opted against radiation given the risk of hypogonadism. (a) (b) (c) (a) (b) (c) Figure 1 (a) Initial: MRI pituitary with and without contrast showing a coronal T1 postcontrast image immediately prior to our patient’s pituitary surgery. The red arrow points to a 3 × 3 × 5 mm hypoenhancing focus representing a pituitary microadenoma. (b) Postsurgical: MRI pituitary with and without contrast showing a coronal T1 postcontrast image obtained three months after transsphenoidal pituitary surgery. The red arrow shows that a hypoenhancing focus is no longer seen and has been resected. (c) Postpartum: MRI pituitary with and without contrast showing a coronal T1 postcontrast image obtained four weeks postpartum. The red arrow points to a 3 mm relatively hypoenhancing lesion representing a recurrent pituitary adenoma. Table 1 24-hour urine-free cortisol measurements collected approximately every 8 weeks throughout our patient’s pregnancy. 3. Discussion The symptoms and signs of Cushing’s syndrome overlap with those seen in normal pregnancy, making diagnosis of Cushing’s disease during pregnancy challenging [1]. Potential mechanisms of gestational hypercortisolemia include increased systemic cortisol resistance during pregnancy, decreased sensitivity of plasma ACTH to negative feedback causing an altered pituitary ACTH setpoint, and noncircadian secretion of placental CRH during pregnancy causing stimulation of the maternal HPA axis [5]. Consequently, both urinary excretion of cortisol and late-night salivary cortisol undergo a gradual increase during normal pregnancy, beginning at the 11th week of gestation [2]. Cushing’s disease is suggested by 24-hour urinary-free cortisol levels greater than 3-fold of the upper limit of normal [2]. It has also been suggested that nocturnal salivary cortisol be used to diagnose Cushing’s disease by using the following specific trimester thresholds: first trimester, 0.25 μg/dL; second trimester, 0.26 μg/dL; third trimester 0.33, μg/dL [11]. By these criteria, our patient had no signs or biochemical evidence of CD during pregnancy but developed CD 4 weeks postpartum. A recent study by Tang et al. proposed that there may be a higher risk of developing CD in the peripartum period, but did not test for CD during pregnancy, and therefore was not able to definitively say exactly when CD onset occurred in relation to pregnancy [4]. Previous literature suggests that there may be a higher risk of ACTH-secreting pituitary adenomas following pregnancy as there is a significant surge of ACTH and cortisol hormones at the time of labor. This increased stimulation of the pituitary corticotrophs in the immediate postpartum period may promote tumorigenesis [6]. It has also been suggested that the hormonal milieu during pregnancy may cause accelerated growth of otherwise dormant or small slow-growing pituitary corticotroph adenomas [4, 5]. However, the underlying mechanisms of CD development in the postpartum period have yet to be clarified. We highlight the need for more research to investigate not only the development, but also the risk of CD recurrence in the postpartum period. Such research would be helpful for family planning. 4. Conclusion Hypothalamic-pituitary-adrenal axis activation during pregnancy and the immediate postpartum period may result in higher rates of CD recurrence in the postpartum period, as seen in our patient. In general, more testing for CS in all reproductive-age females with symptoms suggesting CS, especially during and after childbirth, is necessary. Such testing can also help us determine when CD occurred in relation to pregnancy, so that we can further understand the link between pregnancy and CD occurrence, recurrence, and/or persistence. Learning about the potential mechanisms of CD development and recurrence in pregnancy will help us to counsel these reproductive-age women who desire pregnancy. Abbreviations CD: Cushing’s disease TSA: Transsphenoidal resection DST: Dexamethasone suppression test ACTH: Adrenocorticotropic hormone MRI: Magnetic-resonance imaging HC: Hydrocortisone CTH: Corticotroph-releasing hormone HPA: Hypothalamic-pituitary-adrenal. Data Availability The data used to support the findings of this study are included within the article. Additional Points Note. Peripartum refers to the period immediately before, during, or after pregnancy and postpartum refers to any period after pregnancy up until 1 year postdelivery. Disclosure This case report is a follow up to an abstract that was presented in ENDO 2020 Abstracts. https://doi.org/10.1210/jendso/bvaa046.2128. Conflicts of Interest The authors declare that they have no conflicts of interest. Acknowledgments The authors thank Dr. Puneet Pawha for his help in reviewing MRI images and his suggestions. References J. R. Lindsay and L. K. Nieman, “The hypothalamic-pituitary-adrenal axis in pregnancy: challenges in disease detection and treatment,” Endocrine Reviews, vol. 26, no. 6, pp. 775–799, 2005.View at: Publisher Site | Google Scholar W. Huang, M. E. Molitch, and M. E. Molitch, “Pituitary tumors in pregnancy,” Endocrinology and Metabolism Clinics of North America, vol. 48, no. 3, pp. 569–581, 2019.View at: Publisher Site | Google Scholar M. C. Machado, M. C. B. V. Fragoso, M. D. Bronstein, and M. Delano, “Pregnancy in patients with cushing’s syndrome,” Endocrinology and Metabolism Clinics of North America, vol. 47, no. 2, pp. 441–449, 2018.View at: Publisher Site | Google Scholar K. Tang, L. Lu, M. Feng et al., “The incidence of pregnancy-associated Cushing’s disease and its relation to pregnancy: a retrospective study,” Frontiers in Endocrinology, vol. 11, p. 305, 2020.View at: Publisher Site | Google Scholar S. K. Palejwala, A. R. Conger, A. A. Eisenberg et al., “Pregnancy-associated Cushing’s disease? an exploratory retrospective study,” Pituitary, vol. 21, no. 6, pp. 584–592, 2018.View at: Publisher Site | Google Scholar G. Mastorakos and I. Ilias, “Maternal and fetal hypothalamic-pituitary-adrenal axes during pregnancy and postpartum,” Annals of the New York Academy of Sciences, vol. 997, no. 1, pp. 136–149, 2003.View at: Publisher Site | Google Scholar G. F. Yaylali, F. Akin, E. Yerlikaya, S. Topsakal, and D. Herek, “Cushing’s disease recurrence after pregnancy,” Endocrine Abstracts, vol. 32, 2013.View at: Publisher Site | Google Scholar C. V. L. Fellipe, R. Muniz, L. Stefanello, N. M. Massucati, and L. Warszawski, “Cushing’s disease recurrence during peripartum period: a case report,” Endocrine Abstracts, vol. 70, 2020.View at: Publisher Site | Google Scholar P. Recinos, M. Abbassy, V. Kshettry et al., “Surgical management of recurrent Cushing’s disease in pregnancy: a case report,” Surgical Neurology International, vol. 6, no. 26, pp. S640–S645, 2015.View at: Publisher Site | Google Scholar A. Nakhleh, L. Saiegh, M. Reut, M. S. Ahmad, I. W. Pearl, and C. Shechner, “Cabergoline treatment for recurrent Cushing’s disease during pregnancy,” Hormones, vol. 15, no. 3, pp. 453–458, 2016.View at: Publisher Site | Google Scholar L. M. L. Lopes, R. P. V. Francisco, M. A. K. Galletta, and M. D. Bronstein, “Determination of nighttime salivary cortisol during pregnancy: comparison with values in non-pregnancy and cushing’s disease,” Pituitary, vol. 19, no. 1, pp. 30–38, 2015.View at: Publisher Site | Google Scholar Copyright Copyright © 2022 Leena Shah et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. From https://www.hindawi.com/journals/crie/2022/9236711/
  16. Abstract MiRNAs are important epigenetic players with tissue- and disease-specific effects. In this study, our aim was to investigate the putative differential expression of miRNAs in adrenal tissues from different forms of Cushing’s syndrome (CS). For this, miRNA-based next-generation sequencing was performed in adrenal tissues taken from patients with ACTH-independent cortisol-producing adrenocortical adenomas (CPA), from patients with ACTH-dependent pituitary Cushing’s disease (CD) after bilateral adrenalectomy, and from control subjects. A confirmatory QPCR was also performed in adrenals from patients with other CS subtypes, such as primary bilateral macronodular hyperplasia and ectopic CS. Sequencing revealed significant differences in the miRNA profiles of CD and CPA. QPCR revealed the upregulated expression of miR-1247-5p in CPA and PBMAH (log2 fold change > 2.5, p < 0.05). MiR-379-5p was found to be upregulated in PBMAH and CD (log2 fold change > 1.8, p < 0.05). Analyses of miR-1247-5p and miR-379-5p expression in the adrenals of mice which had been exposed to short-term ACTH stimulation showed no influence on the adrenal miRNA expression profiles. For miRNA-specific target prediction, RNA-seq data from the adrenals of CPA, PBMAH, and control samples were analyzed with different bioinformatic platforms. The analyses revealed that both miR-1247-5p and miR-379-5p target specific genes in the WNT signaling pathway. In conclusion, this study identified distinct adrenal miRNAs as being associated with CS subtypes. Keywords: cortisol; ACTH; miRNA; Cushing’s; hypercortisolism; pituitary 1. Introduction Cushing’s syndrome (CS) results from the excessive secretion of cortisol, leading to visceral obesity, resistance to insulin, osteoporosis, and altered lipid and glucose metabolism [1,2]. Excessive production of cortisol by the adrenal glands can be either ACTH-dependent or -independent. In the majority of patients, hypercortisolism is due to ACTH secretion by corticotroph adenomas of the pituitary gland (Cushing’s disease, CD) or by ectopic tumors [3]. Approximately 20% of cases are ACTH-independent, where cortisol is secreted autonomously by the adrenal cortex. The pathology of ACTH-independent cases is diverse; they are most often caused by unilateral cortisol-producing adrenocortical adenomas (CPA). Rare causes are cortisol-secreting adrenocortical carcinomas (ACC), primary bilateral macronodular adrenocortical hyperplasia (PBMAH), bilateral CPAs, and primary pigmented nodular adrenal disease (PPNAD) [4,5]. Irrespective of the subtype, prolonged exposure to cortisol in CS is associated with increased mortality and cardiovascular morbidity in its patients [6]. Treatment is based on the underlying cause of hypercortisolism, with pituitary surgery or adrenalectomy being the preferred choice. Medical therapy options in CS are few and consist of pituitary-directed drugs, steroid synthesis inhibitors, and glucocorticoid receptor antagonists [7]. For the timely diagnosis and targeted management of CS and its subtypes, a comprehensive understanding of cortisol secretion, in terms of canonical signaling pathways as well as upstream epigenetic factors, is needed. MiRNA molecules have emerged as key epigenetic players in the transcriptional regulation of cortisol production. Briefly, the deletion of Dicer in adrenals, a key miRNA processing enzyme, revealed diverse expression changes in miRNAs along with related changes in steroidogenic enzymes such as Cyp11b1 [8]. Furthermore, key enzymes in the cortisol biosynthesis pathway, namely Cyp11a1, Cyp21a1, Cyp17a1, Cyp11b1, and Cyp11b2, were also found to be regulated by various miRNAs (miRNA-24, miRNA-125a-5p, miRNA-125b-5p, and miRNA-320a-3p) in in vitro studies [9]. Consequently, various studies have also characterized miRNA expression profiles in CS subtypes. Importantly, miRNA expression in the corticotropinomas of CD patients was found to vary according to USP8 mutation status [10]. Other studies have also identified specific miRNA candidates and associated target genes in the adrenals of patients with PPNAD [11], PBMAH [12,13], and massive macronodular adrenocortical disease [14]. Interestingly, no common miRNA candidates were found among these studies, indicating the specificity of miRNAs to the different underlying pathologies in CS. There are limited studies directly comparing miRNA expression profiles of ACTH-dependent and ACTH-independent CS patients. Consequently, in our previous study, we found differences in expression profiles when comparing circulating miRNAs in CD and CPA patients [15]. We hypothesized that the presence of ACTH possibly influences the miRNA profile in serum due to the upstream differential expression in the origin tissues. In this study, we aim to further explore this hypothesis by comparing the miRNA expression profile of adrenal tissues in ACTH-dependent and ACTH-independent CS. In brief, miRNA specific sequencing was performed in two prevalent subtypes of CS: in CD, the most prevalent ACTH-dependent form; and in CPA, the most prevalent ACTH-independent form. Specific miRNA candidates related to each subtype were further validated in other forms of CS. To further investigate our hypothesis, the response of miRNA candidates following ACTH stimulation was assessed in mice, and the expression of miRNAs in murine adrenals was subsequently investigated. Finally, an extensive targeted gene analysis was performed based on in silico predictions, RNA-seq data, and luciferase assays. 2. Results 2.1. Differentially Expressed miRNAs NGS revealed differentially expressed miRNAs between the different groups analyzed (Figure 1). CD and CPA taken together as CS showed a differentially expressed profile (42 significant miRNAs) in comparison to controls. Moreover, individually, CPA and CD were found to show a significantly different expression profile in comparison to controls (n = 38 and n = 17 miRNAs, respectively). Interestingly, there were no significantly upregulated genes in the adrenals of patients with CD in comparison to the control adrenals. A comparative analysis of the top significant miRNAs (log2 fold change (log2 FC) > 1.25 & p < 0.005) between the two groups was performed and the representative Venn diagrams are given in Figure 2. Briefly, miR-1247-5p, miR-139-3p, and miR-503-5p were significantly upregulated in CPA, in comparison to both CD and controls. Furthermore, miR-150-5p was specifically upregulated in CPA as compared to CD. Several miRNAs (miR-486-5p, miR-551b-3p, miR-144-5p, miR-144-3p, and miR-363-3p) were found to be significantly downregulated in the groups of CPA and CD in comparison to controls. MiR-19a-3p and miR-873-5p were found to be commonly downregulated in CPA in comparison to both CD and controls. Principal component analyses based on miRNA sequencing did not identify any major clusters among the samples. Furthermore, the miRNA profile was not different among the CPA samples based on the mutation status of PRKACA (Supplementary Materials Figure S1). Figure 1. Differentially expressed miRNAs from sequencing. Volcano plot showing the relationship between fold change (log2 fold change) and statistical significance (−log10 p value). The red points in the plot represent significantly upregulated miRNAs, while blue points represent significantly downregulated miRNAs. CPA, cortisol producing adenoma; CD, Cushing’s disease; Cushing’s syndrome represents CPA and CD, taken together. Figure 2. Venn analyses of the common significant miRNAs from each group. The significantly expressed miRNAs from each sequencing analysis were shortlisted and compared between the groups. CPA, cortisol producing adenoma; CD, Cushing’s disease. 2.2. Validation and Selection of Candidate miRNAs For validation by QPCR, the most significant differentially expressed miRNAs (log2 FC > 1.25 & p < 0.005) among the groups were chosen (Table S1). According to the current knowledge, upregulated miRNAs are known to contribute more to pathology than downregulated miRNAs [16]. Since the total number of significantly upregulated miRNAs was six, all these miRNAs were chosen for validation. Contrarily, 25 miRNAs were significantly downregulated among the groups. In particular, miR-486-5p, miR-551b-3p, miR-144-5p, miR-144-3p, and miR-363-3p were found to be commonly downregulated in the CS group in comparison to controls; therefore, these miRNAs were chosen for validation. Among the upregulated miRNA candidates, miR-1247-5p QPCR expression confirmed the NGS data (Figure 3A, Table S1). Moreover, miR-150-5p and miR-139-3p were upregulated in CPA specifically in comparison to CD, and miR-379-5p was upregulated in CD in comparison to controls by QPCR. In the case of downregulated genes, none of the selected miRNAs could be confirmed by QPCR (Figure 3B). Thus, analysis of the six upregulated and five downregulated miRNAs from NGS yielded two significantly upregulated miRNA candidates, miR-1247-5p in CPA and miR-379-5p in CD, when compared to controls. These miRNA candidates were taken up for further QPCR validation in an independent cohort of other subtypes of CS (Figure 4), namely ACTH-dependent ectopic CS (n = 3) and ACTH-independent PBMAH (n = 10). The QPCR analysis in the other subtypes revealed miR-1247-5p to be consistently upregulated in ACTH-independent CS (PBMAH and CPA) in comparison to ACTH-dependent CS (CD and ectopic CS) and controls. On the other hand, miR-379-5p was upregulated in CD and PBMAH in comparison to controls. Figure 3. QPCR analyses of significant miRNAs from sequencing analyses. Data are represented as mean ± standard deviation (SD) of −dCT values: (A) Expression analysis of significantly upregulated miRNAs; (B) Expression analysis of common significantly downregulated miRNAs. Housekeeping gene: miR-16-5p. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*). Figure 4. QPCR analyses of significantly upregulated miRNAs from validation QPCR. Data are represented as mean ± standard deviation (SD) of −dCT values. Housekeeping gene: miR-16-5p. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*). 2.3. In Vivo Assessment of ACTH-Independent miR-1247-5p To analyze the influence of ACTH on miRNA expression, the expression of miR-1247-5p and miR-379-5p were assessed in the adrenal tissues of ACTH stimulated mice at different time points. For this analysis, miR-96-5p was taken as a positive control, as it has previously been reported to be differentially expressed in ACTH stimulated mice [17]. The analyses revealed that the expression of miR-1247-5p and miR-379-5p did not change at different timepoints of the ACTH stimulation (Figure 5). Meanwhile, the positive control of mir-96-5p showed a dynamic expression pattern with upregulation after 10 min, followed by downregulation at the subsequent 30 and 60 min time points, in concordance with previously reported findings [18]. Figure 5. Analysis of miRNA expression in ACTH stimulated mice tissue. QPCR analyses of positive controls, miR-96-5p, and candidates miR-379-5p and miR-1247-5p. Mice were injected with ACTH, and adrenals were collected at different timepoints to assess the impact of ACTH on miRNA expression. Data are represented as mean ± standard deviation (SD) of −dCT values. Housekeeping gene: miR-26a-5p. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*). 2.4. In Silico Analyses of miRNA Targets Two diverse approaches were employed for a comprehensive in silico analysis of the miRNA targets. First, the predicted targets of miR-1247-5p and miR-379-5p were taken from the TargetScan database, which identified miRNA–mRNA target pairs based on sequence analyses [19]. The expression status of these targets was then checked in the RNA sequencing data from CPA vs. controls (miR-1247-5p) and PBMAH vs. controls (miR-379-5p). Targets that showed significant expression changes in the sequencing data were shortlisted (Figure 6A). Among the 1061 predicted miR-1247-5p targets, 28 genes were found to show significant expression changes in CPA (20 upregulated, 8 downregulated). On the other hand, for 124 predicted miR-379-5p targets, 23 genes were found to show significant expression changes in PBMAH (20 upregulated, 3 downregulated). Interestingly, the selected targets were found to be unique for each miRNA, except for FICD (FIC domain protein adenylyltransferase) (Figure 6B). Figure 6. (A) Differentially expressed target genes of miRNAs from sequencing. Data are represented as log2 fold change in comparison to the controls. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05. (B) Venn analyses of common significant miRNA target genes and related pathways. The significantly expressed targets from each sequencing analysis were shortlisted and compared between the groups. Predicted pathways of the targets from the Panther database were shortlisted and compared between the groups. 2.5. In Vitro Analyses of miR-1247-5p Targets For in vitro analyses, we focused on downregulated targets, as we expect our upregulated miRNA candidates to cause a downregulation of the target mRNAs. For our downregulated mRNAs, only targets of miR-1247-5p were found to have published links to CS, namely Cyb5a, Gabbr2, and Gnaq (Table 1). Therefore, these three targets were then verified by QPCR in the groups of CPA, CD, PBMAH, ectopic CS, and controls (Figure 6). Only Cyb5A was found to be significantly downregulated in ACTH-dependent forms (ectopic CS and CD) as well as in ACTH-independent CS (PBMAH and CPA) in comparison to controls. Consequently, to assess whether Cyb5a is indeed regulated by miR-1247-5p, a dual luciferase assay was performed. To prove our hypothesis, treatment of Cyb5a-WT cells with miR-1247-5p mimic was expected to lead to a reduced luminescence, whereas no effects were expected in cells treated with the miR-1247-5p inhibitor or the Cyb5a-mutant (with a mutation in the miR-1247-5p binding site). As shown in Figure 7, transfection of miR-1247-5p significantly reduced luminescence from Cyb5a-WT in comparison to cells transfected with Cyb5a-WT and miR-1247-5p inhibitors. However, these predicted binding results were not found to be specific, as there were no significant differences when compared to wells transfected with Cyb5a-WT alone (Figure 8). Consecutively, when the mutated Cyb5a-Mut were transfected along with the mimics and inhibitors, no significant differences in luminescence were observed in the transfected population. Thus, direct interaction between miR-1247-5p and its predicted target gene Cyb5A could not be conclusively proven using this luciferase assay. Figure 7. QPCR analyses of the top predicted targets of miR-1247-5p. Data are represented as mean ± standard deviation (SD) of −dCT values. Housekeeping gene: PPIA. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p-value < 0.05 (*). Figure 8. Results of dual luminescence assay on cells transfected with miR-1247-5p mimics and related controls. Cells were transfected with plasmids containing either the WT or Mut miRNA binding sequence in Cyb5a. Either miR-1247-5p mimics or miR-1247-5p inhibitors were transfected together with the respective plasmids. Data are represented as mean ± standard error of mean (SEM) of relative luminescence unit values. Statistics: ANOVA test with Bonferroni correction to detect significant differences between patient groups with at least a significance of p value < 0.05 (*). Table 1. Analysis of the predicted targets of miR-1247-5p and their expression levels in comparison to controls (log2 fold change). Published literature on target genes in reference to CS is highlighted in bold. 2.6. Pathway Analyses of miRNA Targets For the pathway analysis (Reactome) we used the 28 predicted miRNA-1247-5p targets and the 23 predicted miRNA-379-5p targets from TargetScan, which were significantly differently expressed in the RNA-seq (Figure 6). Concurrently, the pathways commonly enriched by both miRNAs included the WNT signaling pathway and N-acetyl-glucosamine synthesis (Figure 9A). As a complementary approach, in silico analyses were also performed based on the targets from miRTarBase. In this database, targets are shortlisted based on published experimental results. In this analysis, miR-1247-5p (n = 21) and miR-379-5p targets (n = 85) were unique. While the validated targets of miR-379-5p were found to show significant changes in expression in the RNA-seq data from PBMAH (n = 12), none of the validated miR-1247-5p targets were found to show significant expression changes in the RNA-seq data from CPA. Therefore, all the validated targets of the miRNAs were subjected to pathway analyses (Panther). Interestingly, the WNT signaling pathway was also found to be commonly regulated by both miRNAs using this approach (Figure 9B). Finally, the expression status of target genes related to WNT signaling pathways were checked in our RNA-seq data (Figure S2). Given the upregulated status of the miRNAs, a downregulated expression of its target genes was expected. However, a significantly upregulated expression was observed for DVL1 in CPA in comparison to controls and for ROR1 in PBMAH in comparison to controls. Figure 9. Pathway analyses of miRNA target genes. (A) The predicted targets were matched with the RNA-seq expression data. For miR-1247-5p, CPA vs. controls expression data; and for miR-379-5p, PBMAH vs. controls expression data. The significantly expressed target genes were then subjected to pathway analyses by Reactome. The significantly enriched pathway networks (p < 0.05) and their related genes are given. (B) The experimentally validated target genes from miRTarBase were analyzed for their role in pathways by the Panther database. The target genes and their related pathways are given. The commonly represented pathways are marked in bold. 3. Discussion MiRNAs are fine regulators of both physiology and pathology and have diverse roles as diagnostic biomarkers as well as therapeutic targets. While circulating miRNAs have been investigated as potential biomarkers for hypercortisolism in CS subtypes (36), comprehensive analyses of their pathological role in CS subtypes have not yet been performed. This study hoped to uncover the pathological role of miRNAs in different CS subtypes as well as identify unique epigenetic targets contributing to hypercortisolism in these subtypes. As such, miRNA sequencing was performed in the ACTH-independent CPA and ACTH-dependent CD, with additional QPCR validation in PBMAH and ectopic CS. As expected, miRNA expression profiles in CD and CPA were very different. 3.1. ACTH-Independent Upregulated miRNAs in CS Among the analyzed miRNAs, only miR-1247-5p and miR-379-5p showed the most prominent changes in expression levels. Briefly, miR-1247-5p was significantly upregulated in ACTH-independent forms of CS, CPA, and PBMAH (Figure 1 and Figure 3) while miR-379-5p was found to be upregulated in CD and PBMAH, in comparison to controls. Even though CD and PBMAH represent CS subtypes with different ACTH dependence, albeit both with hyperplastic tissue, it is interesting to find a shared miRNA expression status. Concurrently, miRNAs have been identified as dynamic players in regulating the acute effect of ACTH on adrenal steroidogenesis in in vivo murine studies [20,21]. Further diverse miRNAs have been characterized to regulate steroidogenesis in ACTH and dexamethasone treated rats [22] (suppressed ACTH) as well as in in vitro studies [20]. It is possible that miR-379-5p contributes to the adrenal hyperplasia present in both PBMAH and CD by targeting specific genes related to hyperplasia, and miR-1247-5p by contributing to cortisol production independent of ACTH regulation in CPA and PBMAH. Interestingly, the miRNA candidates (mir-1247-5p and miR-379-5p) in our study have not been previously characterized in any of these studies. Furthermore, the expression of mir-1247-5p and miR-379-5p were found to be independent of ACTH stimulation, underlying their role in CS independently of the HPA axis control and postulating specific regulatory processes. 3.2. Target Genes of miRNAs in CS Initially, we focused on the selection of known CS specific target genes that could be directly repressed by miRNAs, thereby contributing to pathology. The predicted target genes of miR-1247-5p and miR-379-5p were assessed for their downregulated expression status in the RNA-seq data. Among the selected target genes, only Cyb5a was found to be significantly downregulated in all forms of CS (Figure 6). Cytochrome b5 (CYB5A) is a marker of the zona reticularis and is an important regulator of androstenedione production [23,24]. Based on its role in adrenal steroidogenesis, it is possible that Cyb5a is downregulated by miR1247-5p. To prove our hypothesis, a dual luciferase assay was performed in HELA cell line to identify a direct interaction between Cyb5a and miR-1247-5p (Figure 7). Unfortunately, a direct interaction could not be proven, indicating that miR-1247-5p perhaps regulates its target genes in different ways. 3.3. Pathway Analyses of miRNA Targets To identify miRNA specific regulatory processes, comprehensive target and pathway analyses were performed. Independent pathway analyses of the respective targets with two different databases of Reactome and Panther showed the WNT signaling pathway as a common targeted pathway of both mir-1247-5p and miR-379-5p (Figure 8). The WNT signaling pathway represents a crucial regulator in diverse developmental as well as pathological processes with tissue-specific effects [25,26]. Consequently, the WNT pathway has been largely characterized as one of the dysregulated pathophysiological mechanisms in CPA. Mutations in PRKACA, one of the WNT signaling proteins, are present in approximately 40% of CPA [27]. In the case of CD, dysregulated WNT signaling has been characterized as promoting proliferation in ACTH-secreting pituitary adenomas [28]. Moreover, activating mutations in beta catenin, one of the WNT signaling pathways, has been characterized as driving adrenal hyperplasia through both proliferation-dependent and -independent mechanisms [29]. Thus, it could be hypothesized that by targeting specific genes in the pathway, miRNAs drive specific pathophysiological processes in diverse CS subtypes. 3.4. MiRNA Target Genes in WNT Signaling DVL1 (TargetScan) and DVL3 (miRTar) are the shortlisted target genes of miR-1247-5p in the WNT signaling pathway. These genes are members of canonical WNT pathways and, importantly, activation of the cytoplasmic effector Dishevelled (Dvl) is a critical step in WNT/β-catenin signaling initiation [30,31]. Interestingly, no difference in DVL1 and DVL3 gene expression was found in the analyses of ACTH-secreting pituitary adenomas [32]. Therefore, it could be possible that DVL1 and DVL3 are only targeted by miR-1247-5p specifically in the adrenal of CPA and PBMAH patients, leading to its characterized tumor progression. EDN1, TGFBR1 (TargetScan), and ROR1 (miRTar) were the target genes of miR-379-5p related to the WNT pathway. In epithelial ovarian cancer, Endothelin-1 (EDN-1) was found to regulate the epithelial–mesenchymal transition (EMT) and a chemoresistant phenotype [33]. In the case of receptor tyrosine kinase-like orphan receptor 1 (ROR1), higher expression of the gene was associated with a poor prognosis in ovarian cancer [34]. Concurrently, suppression of TGFBR1-mediated signaling by conditional knockout in mice was found to drive the pathogenesis of endometrial hyperplasia, independent of the influence of ovarian hormones [35]. Therefore, it could be hypothesized that the dysregulated expression of these factors in adrenals could trigger similar hyperplastic effects mediated by these factors, as in ovarian tissues. 3.5. Bottlenecks and Future Outlook Interestingly, among these genes, only DVL1 and ROR1 were found to be significantly upregulated in the RNA-seq data (Figure S2). The major regulatory role of miRNAs in gene expression come from their ability to repress gene expression at the level of transcription and translation. There are also reports of miRNA-mediated gene upregulation; however, the physiological evidence of the role is still unresolved [36]. Therefore, it is interesting to see the selected targets of miR-1247-5p and miR-379-5p upregulated. Moreover, it should be noted that most of the experimentally validated miRNA targets were identified by CLIP methods [37]. Crosslinking immunoprecipitation (CLIP) are binding assays that provide genome-wide maps of potential miRNA-target gene interactions based on sequencing. Moreover, these assays do not make functional predictions on the outcome of miRNA binding, and neither do upregulation or downregulation [38,39]. Therefore, in our current experimental setting, we could only identify potential miRNA target genes and speculate on their pathological role based on the published literature and in silico analyses. Furthermore, extensive mechanistic analyses based on these potential targets could help in elaborating the specific epigenetic pathways that fine-tune CS pathology in different subtypes. 4. Materials and Methods 4.1. Sample Collection and Ethics Approval All patients were registered in the German Cushing’s Registry, the ENS@T or/and NeoExNET databases (project number protocol code 379-10 and 152-10). The study was approved by the Ethics Committee of the University of Munich. All experiments were performed according to relevant guidelines and protocols, and written informed consent was obtained from all patients involved. The adrenal samples used in the sequencing (miRNA and RNA) belong to the same patient. For miRNA-specific next-generation sequencing (NGS), a total of 19 adrenocortical tissue samples were used. The cohort consisted of the following patient groups: ACTH-independent CPA, n = 7; ACTH-dependent hypertrophic adrenals of CD patients after bilateral adrenalectomy, n = 8; normal adjacent adrenal tissue from patients with pheochromocytoma as controls, n = 8. For QPCR validation, the patient groups included adrenal tissue from ACTH-independent PBMAH, n = 10, and ACTH-dependent ectopic CS, n = 3. In the case of mRNA sequencing, a total of 23 adrenocortical tissue samples were used. This includes the following patient groups: CPA, n = 7; PBMAH, n = 8; normal adjacent adrenal tissue from patients with pheochromocytoma as controls, n = 8. The clinical characteristics of the patients are given in Table 2. Furthermore, of the eight CPA samples in the study, three of them carried known somatic driver mutations in the PRKACA gene and in the ten PBMAH samples, two carried germline mutations in the ARMC5 gene. Table 2. Clinical characteristics of the patient groups. Data are given as median with 25th and 75th percentiles in brackets. CPA, cortisol producing adenoma; CD, Cushing’s disease. The adrenal tissues were stored at −80 °C. Total RNA isolation was carried out from all adrenal cortex samples by an RNeasy Tissue Kit (Qiagen, Hilden, Germany). The isolated RNA was kept frozen at −80 °C until further use. 4.2. MiRNA and RNA Sequencing RNA integrity and the absence of contaminating DNA were confirmed by Bioanalyzer RNA Nano (Agilent Technologies, Santa Clara, CA, USA) and by Qubit DNA High sensitivity kits, respectively. Sequencing libraries were prepared using the Illumina TruSeq Small RNA Library Preparation Kit. NGS was performed on 2 lanes of an Illumina HiSeq2500 (Illumina, CA, USA) multiplexing all samples (paired end read, 50 bp). The quality of sequencing reads was verified using FastQC0.11.5 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc, date last accessed: 13 March 2020) before and after trimming. Adapters were trimmed using cutadapt [40]. Reads with <15 bp and >40 bp insert sequences were discarded. An alignment of reads was performed using miRBase V21 [41,42] with sRNAbench [43]. EdgeR and DeSeq in R were used for further analyses [44,45]. MiRNAs with at least 5 raw counts per library were included. RNA-seq was performed by Qiagen, Hilden, Germany. For mRNA, sequencing was performed on Illumina NextSeq (single end read, 75 bp). Adapter and quality trimming were performed by the “Trim Reads” tool from CLC Genomics Workbench. Furthermore, reads were trimmed based on quality scores. The QC reports were generated by the “QC for Sequencing Reads” tool from CLC Genomics Workbench. Read mapping and gene quantification were performed by the “RNA-seq Analysis” tool from CLC Genomics Workbench [46]. The miRNA-seq data generated in this study have been submitted to the NCBI (PRJNA847385). 4.3. Validation of Individual miRNAs MiRNAs and genes significantly differentially expressed by NGS were validated by QPCR. Reverse transcription of miRNA-specific cDNA was performed by using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, Munich, Germany), and the reverse transcription of RNA genes was done by using the Superscript VILO cDNA synthesis Kit (Thermo Fisher Scientific, Munich, Germany). 50 ng of RNA was used for each of the reverse transcription reactions. Quantitative real-time PCR was performed using the TaqMan Fast Universal PCR Master Mix (2×) (Thermo Fisher Scientific, Munich, Germany) on a Quantstudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Munich, Germany) in accordance with the manufacturer’s protocol. All QPCR reactions were performed in a final reaction volume of 20 μL and with 1 μL of 1:5 diluted cDNA. Negative control reactions contained no cDNA templates. Gene expression was quantified using the relative quantification method by normalization with reference gene [47]. Statistical analysis using the bestkeeper tool was used to compare and select the best reference gene with stable expression across the human adrenal samples [48]. Reference genes with significantly different Ct values (p-value < 0.01) between the samples were excluded. Furthermore, primer efficiency and the associated correlation coefficient R2 of the selected reference gene were determined by the standard curve method in serially diluted cDNA samples [49]. In the case of miRNA reference genes, miR-16-5p [48,50,51] and RNU6B [52] previously used in similar studies were compared. MiR-16-5p was found to show the most stable expression levels across the samples with a p-value of 0.452 in comparison to RNU6B which had a p-value of 0.001. In the case of RNA reference genes, PPIA [53] and GAPDH [54] were compared. Here, PPIA was found to show the most stable expression levels across the samples with a p-value of 0.019 in comparison to GAPDH which had a p-value of 0.003. Therefore, these genes were used for the normalization of miRNA and RNA expression in human adrenal samples. 4.4. Target Screening In silico prediction of the possible miRNA targets was performed using the miRNA target database, TargetScan, and miRTarBase [19,37]. The top predicted targets were further screened based on their expression status in the RNA-seq data from the adrenocortical tissues of CPA, PBMAH, and controls (unpublished data). Pathway analyses of the targets were performed using Reactome [55] and Panther [56] online platforms. The selected downregulated targets were analyzed by QPCR in the adrenocortical samples to confirm their expression status. The successfully validated candidates were then analyzed for regulation by the miRNA using a dual luciferase assay [57]. 4.5. Dual Luciferase Assay The interaction between the predicted 3′-UTR region of Cyb5a and miR-1247-5p was detected using a luciferase activity assay. The 3′UTR sequences of Cyb5a (129 bp) containing the predicted miR-1247-5p binding sites (psiCHECK-2 Cyb5a 3′UTR WT) were cloned into the psiCHECK-2 vector (Promega, Fitchburg, WI, USA). A QuikChange Site-Directed Mutagenesis kit (Agilent Technologies, CA, USA) was used to mutate the miR-1247-5p binding site (psiCHECK-2 Cyb5a 3′UTR mutant) according to the manufacturer’s protocol. All the sequences were verified by Sanger sequencing. Then, 200 ng of the plasmid was used for each transfection. Synthetic miR-1247-5p mimics and specific oligonucleotides that inhibit endogenous miR-1247-5p (miR-1247-5p inhibitors) were purchased from Promega and 100 nmol of the molecules were used for each transfection according to the manufacturer’s protocol. For the assay, HeLa cells were seeded in 96-well plates and incubated for 24 h. The following day, cells were transfected using the following different conditions: (1) psiCHECK-2 Cyb5a 3′UTR WT + miR-1247-5p mimic; (2) psiCHECK-2 Cyb5a 3′UTR WT + miR-1247-5p inhibitor; (3) psiCHECK-2 Cyb5a 3′UTR WT + water; (4) psiCHECK-2 Cyb5a 3′UTR mutant + miR-1247-5p mimic; (5) psiCHECK-2 Cyb5a 3′UTR mutant + miR-1247-5p inhibitor; (6) psiCHECK-2 Cyb5a 3′UTR mutant + water. Forty-eight hours later, luciferase activity in the cells was measured using the dual luciferase assay system (Promega, Fitchburg, WI, USA) in accordance with the manufacturer’s instructions. Renilla luciferase activity was normalized to firefly luciferase activity. Each treatment was performed in triplicate. Any interaction between the cloned gene, Cyb5a (WT and mutant), and miR-1247-5p mimic is accompanied by a decrease in luminescence. This decrease in luminescence would not be observed when the plasmids are transfected with the miR-1247-5p inhibitor, indicating that observed luminescence differences are caused by specific interactions between the plasmid and the miR-1247-5p mimic. Transfection of the plasmid with water corrects any background interactions between the cloned gene and endogenous miRNAs in the culture. 4.6. In Vivo ACTH Stimulation Experiments were performed on 13-week-old C57BL/6 J female mice (Janvier, Le Genest-Saint-Isle, France). Mice were intraperitoneally injected with 1 mg/kg of ACTH (Sigma Aldrich, Munich, Germany) and adrenals were collected after 10, 30, and 60 min of injections. In addition, control adrenals were collected from mice at baseline conditions (0 min). Mice were killed by cervical dislocation and adrenals were isolated, snap-frozen in liquid nitrogen, and stored at −80 °C for later RNA extraction. MiR-26a was taken as a housekeeping gene in the QPCR [58]. All mice were maintained in accordance with facility guidelines on animal welfare and approved by Landesdirektion Sachsen, Chemnitz, Germany. 4.7. Statistical Analysis and Software R version 3.6.1 was used for the statistical analyses. To identify RNAs differentially expressed, a generalized linear model (GLM, a flexible generalization of ordinary linear regression that allows for variables that have distribution patterns other than a normal distribution) in the software package edgeR (Empirical Analysis of DGE in R) was employed to calculate p-values [45,59]. p-values were adjusted using the Benjamin–Hochberg false discovery rate (FDR) procedure [60]. Disease groups were compared using the unpaired Mann–Whitney test, and to decrease the false discovery rate a corrected p-value was calculated using the Benjamin–Hochberg method. p adjusted < 0.05 and log2 fold change >1.25 was applied as the cut-off for significance for NGS data. GraphPad Prism Version 8 was used for the statistical analysis of QPCR. To calculate differential gene expression, the dCt method (delta Ct (cycle threshold) value equals target miRNA’s Ct minus housekeeping miRNA’s Ct) was used (Microsoft Excel 2016, Microsoft, Redmond, WA, USA). For QPCR, an ANOVA test with Bonferroni correction was used [61] to assess significance; p-values < 0.05 were considered significant. 5. Conclusions In conclusion, while comprehensive information regarding the role of miRNAs in acute and chronic phases of steroidogenesis is available, there is little known about the pathological independent role of miRNAs in the pathology of CS. In our study, we have described ACTH-independent miR-1247-5p and miR-379-5p expression in CS for the first time. Thus, by regulating different genes in the WNT signaling pathway, the miRNAs may individually contribute to the Cushing’s pathology in specific subtypes. Supplementary Materials The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms23147676/s1. Author Contributions Conceptualization, S.V., A.C. and A.R.; methodology, S.V., R.Z. and M.E.; software, S.V. and M.E.; validation, R.Z., A.O., D.W. and B.W.; formal analysis, S.V.; investigation, S.V., R.Z., M.E., A.O. and D.W.; resources, A.C., B.W., M.R. and A.R.; data curation, S.V. and R.Z.; writing—original draft preparation, S.V., R.Z. and A.R.; writing—review and editing, S.S., M.R. and A.R.; visualization, S.V.; supervision, A.R.; project administration, A.R.; funding acquisition, A.C., S.S., M.R. and A.R. All authors have read and agreed to the published version of the manuscript. Funding This work was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG) (within the CRC/Transregio 205/1 “The Adrenal: Central Relay in Health and Disease”) to A.C., B.W., S.S., M.R. and A.R., and individual grant SB 52/1-1 to S.S. This work is part of the German Cushing’s Registry CUSTODES and has been supported by a grant from the Else Kröner-Fresenius Stiftung to MR (2012_A103 and 2015_A228). A.R. was supported by the FöFoLe Program of the Ludwig Maximilian University, Munich. We thank I. Shapiro, A. Parl, C. Kühne, and S. Zopp for their technical support. Institutional Review Board Statement The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the Ludwig Maximilian University, Munich (protocol code 379-10, 152-10 and 20 July2021). Informed Consent Statement Informed consent was obtained from all subjects involved in the study. Data Availability Statement The miRNA-seq data generated in this study have been submitted to the NCBI (PRJNA847385). Conflicts of Interest The authors declare no conflict of interest. References Kotłowska, A.; Puzyn, T.; Sworczak, K.; Stepnowski, P.; Szefer, P. Metabolomic biomarkers in urine of cushing’s syndrome pa-tients. Int. J. Mol. Sci. 2017, 18, 294. [Google Scholar] [CrossRef] [PubMed][Green Version] Valassi, E.; Tabarin, A.; Brue, T.; Feelders, R.A.; Reincke, M.; Netea-Maier, R.; Toth, M.; Zacharieva, S.; Webb, S.M.; Tsagarakis, S.; et al. High mortality within 90 days of diagnosis in patients with Cushing’s syndrome: Results from the ERCUSYN registry. Eur. J. Endocrinol. 2019, 181, 461–472. [Google Scholar] [CrossRef] Stratakis, C. Cushing syndrome caused by adrenocortical tumors and hyperplasias (corticotropin-independent Cushing syn-drome). Endocr. Dev. 2008, 13, 117–132. [Google Scholar] Jarial, K.D.S.; Walia, R.; Nahar, U.; Bhansali, A. Primary bilateral adrenal nodular disease with Cushing’s syndrome: Varying aeti-ology. BMJ. Case. Rep. 2017, 2017, bcr2017220154. [Google Scholar] [CrossRef] [PubMed] Kamilaris, C.D.C.; Stratakis, C.A.; Hannah-Shmouni, F. Molecular Genetic and Genomic Alterations in Cushing’s Syndrome and Primary Aldosteronism. Front. Endocrinol. 2021, 12, 142. [Google Scholar] [CrossRef] [PubMed] Feelders, R.A.; Pulgar, S.J.; Kempel, A.; Pereira, A.M. The burden of Cushing’s disease: Clinical and health-related quality of life aspects. Eur. J. Endocrinol. 2012, 167, 311–326. [Google Scholar] [CrossRef] [PubMed][Green Version] Feelders, R.A.; Newell-Price, J.; Pivonello, R.; Nieman, L.K.; Hofland, L.J.; Lacroix, A. Advances in the medical treatment of Cush-ing’s syndrome. Lancet Diabetes Endocrinol. 2019, 7, 300–312. [Google Scholar] [CrossRef] Krill, K.T.; Gurdziel, K.; Heaton, J.H.; Simon, D.P.; Hammer, G.D. Dicer Deficiency Reveals MicroRNAs Predicted to Control Gene Expression in the Developing Adrenal Cortex. Mol. Endocrinol. 2013, 27, 754–768. [Google Scholar] [CrossRef] Robertson, S.; Diver, L.A.; Alvarez-Madrazo, S.; Livie, C.; Ejaz, A.; Fraser, R.; Connell, J.M.; MacKenzie, S.M.; Davies, E. Regulation of Corticosteroidogenic Genes by MicroRNAs. Int. J. Endocrinol. 2017, 2017, 2021903. [Google Scholar] [CrossRef][Green Version] Bujko, M.; Kober, P.; Boresowicz, J.; Rusetska, N.; Zeber-Lubecka, N.; Paziewska, A.; Pekul, M.; Zielinski, G.; Styk, A.; Kunicki, J.; et al. Differential microRNA Expression in USP8-Mutated and Wild-Type Corticotroph Pituitary Tumors Reflect the Difference in Protein Ubiquitination Processes. J. Clin. Med. 2021, 10, 375. [Google Scholar] [CrossRef] Iliopoulos, D.; Bimpaki, E.I.; Nesterova, M.; Stratakis, C.A. MicroRNA Signature of Primary Pigmented Nodular Adrenocortical Disease: Clinical Correlations and Regulation of Wnt Signaling. Cancer Res. 2009, 69, 3278–3282. [Google Scholar] [CrossRef] [PubMed][Green Version] Tan, X.-G.; Zhu, J.; Cui, L. MicroRNA expression signature and target prediction in familial and sporadic primary macronodular adrenal hyperplasia (PMAH). BMC Endocr. Disord. 2022, 22, 11. [Google Scholar] [CrossRef] Vaczlavik, A.; Bouys, L.; Violon, F.; Giannone, G.; Jouinot, A.; Armignacco, R.; Cavalcante, I.P.; Berthon, A.; Letouzé, E.; Vaduva, P.; et al. KDM1A inactivation causes hereditary food-dependent Cushing syndrome. Genet. Med. 2021, 24, 374–383. [Google Scholar] [CrossRef] Bimpaki, E.I.; Iliopoulos, D.; Moraitis, A.; Stratakis, C.A. MicroRNA signature in massive macronodular adrenocortical disease and implications for adrenocortical tumorigenesis. Clin. Endocrinol. 2010, 72, 744–751. [Google Scholar] [CrossRef] Vetrivel, S.; Zhang, R.; Engel, M.; Altieri, B.; Braun, L.; Osswald, A.; Bidlingmaier, M.; Fassnacht, M.; Beuschlein, F.; Reincke, M.; et al. Circulating microRNA Expression in Cushing’s Syndrome. Front. Endocrinol. 2021, 12, 10. [Google Scholar] [CrossRef] [PubMed] O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of microRNA biogenesis, mechanisms of actions, and circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef][Green Version] Butz, H.; Patócs, A. MicroRNAs in endocrine tumors. Electron. J. Int. Fed. Clin. Chem. Lab. Med. 2019, 30, 146–164. [Google Scholar] Riester, A.; Issler, O.; Spyroglou, A.; Rodrig, S.H.; Chen, A.; Beuschlein, F. ACTH-Dependent Regulation of MicroRNA As Endogenous Modulators of Glucocorticoid Receptor Expression in the Adrenal Gland. Endocrinology 2012, 153, 212–222. [Google Scholar] [CrossRef][Green Version] Huang, X.; Zhong, R.; He, X.; Deng, Q.; Peng, X.; Li, J.; Luo, X. Investigations on the mechanism of progesterone in inhibiting endo-metrial cancer cell cycle and viability via regulation of long noncoding RNA NEAT1/microRNA-146b-5p mediated Wnt/β-catenin signaling. IUBMB Life 2019, 71, 223–234. [Google Scholar] [CrossRef][Green Version] Azhar, S.; Dong, D.; Shen, W.-J.; Hu, Z.; Kraemer, F.B. The role of miRNAs in regulating adrenal and gonadal steroidogenesis. J. Mol. Endocrinol. 2020, 64, R21–R43. [Google Scholar] [CrossRef] Allen, M.J.; Sharma, S. Physiology, Adrenocorticotropic Hormone (ACTH). StatPearls 2021. Available online: https://www.ncbi.nlm.nih.gov/books/NBK500031/ (accessed on 8 December 2021). Hu, Z.; Shen, W.-J.; Cortez, Y.; Tang, X.; Liu, L.-F.; Kraemer, F.B.; Azhar, S. Hormonal Regulation of MicroRNA Expression in Steroid Producing Cells of the Ovary, Testis and Adrenal Gland. PLoS ONE 2013, 8, e78040. [Google Scholar] [CrossRef][Green Version] Ghayee, H.K.; Rege, J.; Watumull, L.M.; Nwariaku, F.E.; Carrick, K.S.; Rainey, W.E.; Miller, W.L.; Auchus, R.J. Clinical, biochemical, and molecular characterization of macronodular adrenocortical hyperplasia of the zona reticularis: A new syndrome. J. Clin. Endocrinol. Metab. 2011, 96, E243–E250. [Google Scholar] [CrossRef] [PubMed][Green Version] Nakamura, Y.; Fujishima, F.; Hui, X.-G.; Felizola, S.J.A.; Shibahara, Y.; Akahira, J.-I.; McNamara, K.M.; Rainey, W.E.; Sasano, H. 3βHSD and CYB5A double positive adrenocortical cells during adrenal development/aging. Endocr. Res. 2015, 40, 8–13. [Google Scholar] [CrossRef] [PubMed][Green Version] Ng, L.F.; Kaur, P.; Bunnag, N.; Suresh, J.; Sung, I.C.H.; Tan, Q.H.; Gruber, J.; Tolwinski, N.S. WNT Signaling in Disease. Cells 2019, 8, 826. [Google Scholar] [CrossRef][Green Version] Song, J.L.; Nigam, P.; Tektas, S.S.; Selva, E. microRNA regulation of Wnt signaling pathways in development and disease. Cell. Signal. 2015, 27, 1380–1391. [Google Scholar] [CrossRef][Green Version] Beuschlein, F.; Fassnacht, M.; Assié, G.; Calebiro, D.; Stratakis, C.A.; Osswald, A.; Ronchi, C.L.; Wieland, T.; Sbiera, S.; Faucz, F.R.; et al. Constitutive Activation of PKA Catalytic Subunit in Adrenal Cushing’s Syndrome. N. Engl. J. Med. 2014, 370, 1019–1028. [Google Scholar] [CrossRef][Green Version] Ren, J.; Jian, F.; Jiang, H.; Sun, Y.; Pan, S.; Gu, C.; Chen, X.; Wang, W.; Ning, G.; Bian, L.; et al. Decreased expression of SFRP2 promotes development of the pituitary corticotroph adenoma by upregulating Wnt signaling. Int. J. Oncol. 2018, 52, 1934–1946. [Google Scholar] [CrossRef][Green Version] Pignatti, E.; Leng, S.; Yuchi, Y.; Borges, K.S.; Guagliardo, N.A.; Shah, M.S.; Ruiz-Babot, G.; Kariyawasam, D.; Taketo, M.M.; Miao, J.; et al. Beta-Catenin Causes Adrenal Hyperplasia by Blocking Zonal Transdifferentiation. Cell Rep. 2020, 31, 107524. [Google Scholar] [CrossRef] Grumolato, L.; Liu, G.; Mong, P.; Mudbhary, R.; Biswas, R.; Arroyave, R.; Vijayakumar, S.; Economides, A.N.; Aaronson, S.A. Canonical and noncanonical Wnts use a common mechanism to activate completely unrelated coreceptors. Genes Dev. 2010, 24, 2517–2530. [Google Scholar] [CrossRef][Green Version] Tauriello, D.V.F.; Jordens, I.; Kirchner, K.; Slootstra, J.W.; Kruitwagen, T.; Bouwman, B.A.M.; Noutsou, M.; Rüdiger, S.G.D.; Schwamborn, K.; Schambony, A.; et al. Wnt/β-catenin signaling requires interaction of the Dishevelled DEP domain and C terminus with a discontinuous motif in Frizzled. Proc. Natl. Acad. Sci. USA 2012, 109, E812–E820. [Google Scholar] [CrossRef][Green Version] Colli, L.M.; Saggioro, F.; Neder Serafini, L.; Camargo, R.C.; Machado, H.; Moreira, A.C.; Antonini, S.R.; De Castro, M. Components of the Canonical and Non-Canonical Wnt Pathways Are Not Mis-Expressed in Pituitary Tumors. PLoS ONE 2013, 8, e62424. [Google Scholar] [CrossRef] [PubMed][Green Version] Rosanò, L.; Cianfrocca, R.; Tocci, P.; Spinella, F.; Di Castro, V.; Caprara, V.; Semprucci, E.; Ferrandina, G.; Natali, P.G.; Bagnato, A. En-dothelin A receptor/β-arrestin signaling to the Wnt pathway renders ovarian cancer cells resistant to chemotherapy. Cancer Res. 2014, 74, 7453–7464. [Google Scholar] [CrossRef] [PubMed][Green Version] Zhang, H.; Qiu, J.; Ye, C.; Yang, D.; Gao, L.; Su, Y.; Tang, X.; Xu, N.; Zhang, D.; Xiong, L.; et al. ROR1 expression correlated with poor clinical outcome in human ovarian cancer. Sci. Rep. 2014, 4, 5811. [Google Scholar] [CrossRef] [PubMed][Green Version] Gao, Y.; Li, S.; Li, Q. Uterine epithelial cell proliferation and endometrial hyperplasia: Evidence from a mouse model. Mol. Hum. Reprod. 2014, 20, 776–786. [Google Scholar] [CrossRef] Orang, A.V.; Safaralizadeh, R.; Kazemzadeh-Bavili, M. Mechanisms of miRNA-Mediated Gene Regulation from Common Downregulation to mRNA-Specific Upregulation. Int. J. Genom. 2014, 2014, 970607. [Google Scholar] Huang, H.Y.; Lin, Y.C.D.; Li, J.; Huang, K.Y.; Shrestha, S.; Hong, H.C.; Tang, Y.; Chen, Y.G.; Jin, C.N.; Yu, Y.; et al. miRTarBase 2020: Up-dates to the experimentally validated microRNA–target interaction database. Nucleic Acids Res. 2020, 48, D148–D154. [Google Scholar] [CrossRef] [PubMed][Green Version] Liu, W.; Wang, X. Prediction of functional microRNA targets by integrative modeling of microRNA binding and target expres-sion data. Genome Biol. 2019, 20, 18. [Google Scholar] [CrossRef] [PubMed] Wang, X. Improving microRNA target prediction by modeling with unambiguously identified microRNA-target pairs from CLIP-ligation studies. Bioinformatics 2016, 32, 1316–1322. [Google Scholar] [CrossRef] Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef] Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, D68–D73. [Google Scholar] [CrossRef][Green Version] Griffiths-Jones, S. miRBase: The MicroRNA Sequence Database. Methods Mol. Biol. 2006, 342, 129–138. [Google Scholar] [PubMed] Aparicio-Puerta, E.; Lebrón, R.; Rueda, A.; Gómez-Martín, C.; Giannoukakos, S.; Jáspez, D.; Medina, J.M.; Zubković, A.; Jurak, I.; Fromm, B.; et al. sRNAbench and sRNAtoolbox 2019: Intuitive fast small RNA profiling and differential expression. Nucleic Acids Res. 2019, 47, W530–W535. [Google Scholar] [CrossRef] [PubMed][Green Version] Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [PubMed][Green Version] Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. EdgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef][Green Version] Liu, C.-H.; Di, Y.P. Analysis of RNA Sequencing Data Using CLC Genomics Workbench. Methods Mol. Biol. 2020, 2102, 61–113. [Google Scholar] [CrossRef] Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] Wang, X.; Zhang, X.; Yuan, J.; Wu, J.; Deng, X.; Peng, J.; Wang, S.; Yang, C.; Ge, J.; Zou, Y. Evaluation of the performance of serum miRNAs as normalizers in microRNA studies focused on cardiovascular disease. J. Thorac. Dis. 2018, 10, 2599–2607. [Google Scholar] [CrossRef] Geigges, M.; Gubser, P.M.; Unterstab, G.; Lecoultre, Y.; Paro, R.; Hess, C. Reference Genes for Expression Studies in Human CD8 + Naïve and Effector Memory T Cells under Resting and Activating Conditions. Sci. Rep. 2021, 10, 9411. [Google Scholar] [CrossRef] Song, J.; Bai, Z.; Han, W.; Zhang, J.; Meng, H.; Bi, J.; Ma, X.; Han, S.; Zhang, Z. Identification of Suitable Reference Genes for qPCR Analysis of Serum microRNA in Gastric Cancer Patients. Dig. Dis. Sci. 2011, 57, 897–904. [Google Scholar] [CrossRef] Szabó, D.R.; Luconi, M.; Szabó, P.M.; Tóth, M.; Szücs, N.; Horányi, J.; Nagy, Z.; Mannelli, M.; Patócs, A.; Rácz, K.; et al. Analysis of cir-culating microRNAs in adrenocortical tumors. Lab. Investig. 2014, 94, 331–339. [Google Scholar] [CrossRef][Green Version] Butz, H.; Mészáros, K.; Likó, I.; Patocs, A. Wnt-Signaling Regulated by Glucocorticoid-Induced miRNAs. Int. J. Mol. Sci. 2021, 22, 11778. [Google Scholar] [CrossRef] [PubMed] Muñoz, J.J.; Anauate, A.C.; Amaral, A.G.; Ferreira, F.M.; Watanabe, E.H.; Meca, R.; Ormanji, M.S.; Boim, M.A.; Onuchic, L.F.; Heilberg, I.P. Ppia is the most stable housekeeping gene for qRT-PCR normalization in kidneys of three Pkd1-deficient mouse models. Sci. Rep. 2021, 11, 19798. [Google Scholar] [CrossRef] [PubMed] Xia, X.; Liu, Y.; Liu, L.; Chen, Y.; Wang, H. Selection and verification of the combination of reference genes for RT-qPCR analysis in rat adrenal gland development. J. Steroid. Biochem. Mol. Biol. 2021, 208, 105821. [Google Scholar] [CrossRef] [PubMed] Gillespie, M.; Jassal, B.; Stephan, R.; Milacic, M.; Rothfels, K.; Senff-Ribeiro, A.; Griss, J.; Sevilla, C.; Matthews, L.; Gong, C.; et al. The reactome pathway knowledgebase 2022. Nucleic Acids Res. 2022, 50, D687–D692. [Google Scholar] [CrossRef] Mi, H.; Ebert, D.; Muruganujan, A.; Mills, C.; Albou, L.-P.; Mushayamaha, T.; Thomas, P.D. PANTHER version 16: A revised family classification, tree-based classification tool, enhancer regions and extensive API. Nucleic Acids Res. 2021, 49, D394–D403. [Google Scholar] [CrossRef] Wu, T.; Lin, Y.; Xie, Z. MicroRNA-1247 inhibits cell proliferation by directly targeting ZNF346 in childhood neuroblastoma. Biol. Res. 2018, 51, 13. [Google Scholar] [CrossRef][Green Version] Muñoz, J.J.; Anauate, A.; Amaral, A.G.; Ferreira, F.M.; Meca, R.; Ormanji, M.S.; Boim, M.A.; Onuchic, L.F.; Heilberg, I.P. Identification of housekeeping genes for microRNA expression analysis in kidney tissues of Pkd1 deficient mouse models. Sci. Rep. 2020, 10, 231. [Google Scholar] [CrossRef][Green Version] Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef][Green Version] Hu, Z.; Gao, S.; Lindberg, D.; Panja, D.; Wakabayashi, Y.; Li, K.; Kleinman, J.E.; Zhu, J.; Li, Z. Temporal dynamics of miRNAs in human DLPFC and its association with miRNA dysregulation in schizophrenia. Transl. Psychiatry 2019, 9, 196. [Google Scholar] [CrossRef] Esteva-Socias, M.; Gómez-Romano, F.; Carrillo-Ávila, J.A.; Sánchez-Navarro, A.L.; Villena, C. Impact of different stabilization methods on RT-qPCR results using human lung tissue samples. Sci. Rep. 2020, 10, 3579. [Google Scholar] [CrossRef] Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). From https://www.mdpi.com/1422-0067/23/14/7676/htm
  17. Introduction: Pasireotide (PAS) is a novel somatostatin receptor ligands (SRL), used in controlling hormonal hypersecretion in both acromegaly and Cushing’s Disease (CD). In previous studies and meta-analysis, first-generation SRLs were reported to be able to induce significant tumor shrinkage only in somatotroph adenomas. This systematic review and meta-analysis aim to summarize the effect of PAS on the shrinkage of the pituitary adenomas in patients with acromegaly or CD. Materials and methods: We searched the Medline database for original studies in patients with acromegaly or CD receiving PAS as monotherapy, that assessed the proportion of significant tumor shrinkage in their series. After data extraction and analysis, a random-effect model was used to estimate pooled effects. Quality assessment was performed with a modified Joanna Briggs’s Institute tool and the risk of publication bias was addressed through Egger’s regression and the three-parameter selection model. Results: The electronic search identified 179 and 122 articles respectively for acromegaly and CD. After study selection, six studies considering patients with acromegaly and three with CD fulfilled the eligibility criteria. Overall, 37.7% (95%CI: [18.7%; 61.5%]) of acromegalic patients and 41.2% (95%CI: [22.9%; 62.3%]) of CD patients achieved significant tumor shrinkage. We identified high heterogeneity, especially in acromegaly (I2 of 90% for acromegaly and 47% for CD), according to the low number of studies included. Discussion: PAS treatment is effective in reducing tumor size, especially in acromegalic patients. This result strengthens the role of PAS treatment in pituitary adenomas, particularly in those with an invasive behavior, with progressive growth and/or extrasellar extension, with a low likelihood of surgical gross-total removal, or with large postoperative residual tissue. Systematic Review Registration: https://www.crd.york.ac.uk/prospero/display_record.php?ID=CRD42022328152, identifier CRD42022328152 Introduction Pasireotide (PAS) is a novel somatostatin receptor ligand (SRL) with a high affinity for the somatostatin receptor (SSR) type 5 (1, 2). Somatotroph adenomas are usually responsive to first-generation SRLs (octreotide and lanreotide), as they are able to reduce growth hormone (GH) secretion through SSR type 2 (3). In the flow-chart of acromegaly treatment, PAS is suggested in case of resistance to first-generation SRLs, as SSR type 5 is also abundantly expressed in GH-secreting adenomas (3). A phase III study with PAS long-acting release (LAR) proved its efficacy in first-generation SRLs-resistant acromegalic patients after 6 months (4). In the extension study (Colao A et al.), 37% of patients achieved normalization of insulin-like growth factor 1 (IGF-1) and/or GH levels <1 µg/L, considering both those performing the extension treatment and those crossing over from the first-generation SRL-control group to the PAS LAR group. Nearly two-thirds of responses were achieved after at least 6 months of treatment. Up-titration of the dose from 40 to 60 mg monthly enriched the number of responders, suggesting that the PAS LAR effect may be both time- and dose-dependent (5). Concomitant improvement in signs and symptoms has also been confirmed in other series (6–9). SSR type 5 is the predominant isoform in human corticotroph adenomas, since it is not down-regulated by high cortisol levels, as SSR type 2 does. Therefore, PAS is the only SRL available in patients with Cushing’s Disease (CD) (2). In a phase III study, subcutaneous (s.c.) PAS proved to be effective in normalizing urinary free cortisol (respectively in 13% and 25% of patients taking 600 µg or 900 µg bis-in-die for 12 months) (10), achieving significant clinical improvement (11). In the same clinical setting, PAS LAR showed similar efficacy and safety profiles (12). These benefits could be maintained for up to 5 years in an extension study (13, 14). In a recent meta-analysis, PAS treatment provided disease control in 44% of 522 patients with CD (15). Patients harbouring USP-8 mutations demonstrated an increased SSR type 5 expression in the corticotroph adenoma, increasing the likelihood of a positive response to PAS therapy (16). The safety profile of PAS is similar to that of first-generation SRLs, except for a significant worsening in glucose homeostasis (17). Despite the normalization of hormonal excess, another goal of the medical treatment in GH-secreting pituitary adenomas is the reduction of the size of the adenoma (18). First-generation SRLs proved to be effective in achieving tumor shrinkage in acromegaly: Endocrine Society clinical practice guidelines suggested their role as primary therapy in poor surgical candidates and in those with extrasellar extension without chiasmal compression (18). Cozzi et al. reported in a large prospective cohort of acromegalic patients a significant Octreotide-induced tumor shrinkage in 82% of those receiving SRL as first-line treatment; most of them exhibited an early shrinkage with a progressive trend in reduction later on (19). A meta-analysis of 41 studies reported a significant tumor shrinkage in 50% of included patients (20). Data from the primary treatment with once-monthly lanreotide in surgical naïve patients demonstrated its efficacy in reducing tumor volume, achieving significant tumor shrinkage in 63% of them (21). Hypo-intensity on T2-weighted sequences at baseline magnetic resonance imaging (MRI) seems to predict tumor volume reduction during first-generation SRLs treatment (22). Regarding patients with CD, most patients presented a microadenoma, usually not aggressive or invasive: only in selected cases tumor shrinkage is an aim to achieve in patients with corticotropinoma. As available data are scarce (or limited to selected studies), and the issue of pituitary adenoma shrinkage is of primary importance in the management of tumors that cannot be addressed through surgery, the aim of this systematic review and meta-analysis is to summarize available data regarding the effect of PAS on tumor size. Materials and Methods We used the Population-Intervention-Comparison-Outcome (PICO) model to formulate the research questions for the systematic review (23), as summarised in Figure 1. The systematic review and meta-analysis were conducted and are reported according to the Preferred Reporting Items for Systematic Reviews and Meta-Analysis of Diagnostic Test Accuracy Studies (PRISMA-DTA) statement (24). We registered the protocol on the International Prospective Register of Systematic Reviews database (PROSPERO, https://www.crd.york.ac.uk/PROSPERO, number CRD42022328152). Figure 1 FIGURE 1 PICO (Population-Intervention-Comparison-Outcome) model design to our study. Search Strategy An extensive Medline search was performed for the research question by two of the authors (F.C. and A.M.) independently, discrepancies were resolved by discussion. The literature search was performed up to January 2022, no language restriction was applied. Research included the following keywords: 1) (“acromegalies” [All Fields] OR “acromegaly”[MeSH Terms] OR “acromegaly”[All Fields]) AND (“pasireotide”[Supplementary Concept] OR “pasireotide”[All Fields]); 2) (“pituitary ACTH hypersecretion”[MeSH Terms] OR (“pituitary”[All Fields] AND “ACTH”[All Fields] AND “hypersecretion”[All Fields]) OR “pituitary ACTH hypersecretion”[All Fields]) AND (“pasireotide”[Supplementary Concept] OR “pasireotide”[All Fields]). Inclusion and exclusion criteria were specified in advance and protocol-defined, in order to avoid methodological bias for post-hoc analysis. The searches were designed to select all types of studies (retrospective, observational, controlled, randomized, and non-randomized) conducted in patients with acromegaly or CD treated with PAS as monotherapy; the assessment of the proportion of significant tumor shrinkage was an inclusion criterion. Search terms were linked to Medical Subject Headings when possible. Keywords and free words were used simultaneously. Additional articles were identified with manual searches and included a thorough review of other meta-analyses, review articles, and relevant references. Consolidation of studies was performed with Mendeley Desktop 1.19.8. Study Selection We included all original research studies conducted in adult patients that underwent PAS treatment used as monotherapy (s.c. bis-in-die and intramuscular once/monthly), that provided sufficient information about tumor size reduction during treatment. In case of overlapping cohorts of patients (as clinical trials with core and extension phases), we included only the extension study, in order to select those patients with measurable tumor shrinkage after long-term treatment. Local reports regarding patients involved in multicenter trials were excluded from the analysis, as they had been already considered in the larger series. Reviewers were not blinded to the authors or journals when screening articles. Data Extraction and Quality Assessment Two authors (F.C. and A.M.) read the included papers and extracted independently relevant data, any disagreements were resolved by discussion. If data were not clear from the original manuscript, the authors of the primary study were contacted to clarify the doubts. Contents of data extraction in the selected paper included: name of the first author, year of publication, setting (referral centre, academic hospital, mono- or multi-centric collection), type of treatment, its dose schedule and duration, pituitary imaging method during follow- up, the endpoint type regarding adenoma size analysis (i.e. primary vs exploratory). When data were reported for each patient or for subgroups, a global percentage of significant tumor shrinkage was calculated considering all subjects involved in the study. To assess the risk of bias in the included studies, the critical appraisal tool from Joanna Briggs’s Institute (JBI) was adapted to evaluate those considered in our metanalysis (25). Among the items proposed, we selected the most appropriate to our setting: 1. Were the inclusion criteria clearly identified? 2. Were diagnostic criteria for acromegaly or CD well defined? 3. Were valid methods applied to evaluate tumor shrinkage? 4. Was the inclusion of participants consecutive and complete? 5. Was the reporting of baseline participants’ features (demographic and clinical) complete? 6. Was the report of the outcomes clear? 7. Was the report of demographics of the involved sites complete? 8. Was statistical analysis appropriate? For each aspect we assigned as possible choices of answer: yes, no or unclear. Data Synthesis and Analysis A qualitative synthesis was performed summarizing the study design and population characteristics (age, male to female ratio, macro- to micro-adenoma ratio, prior treatments). A random-effect model was used to estimate pooled effects. Forest plots for percentages of significant tumor size reduction were generated to visualize heterogeneity among the studies. In order to assess publication bias, despite the low number of articles considered, we performed funnel plot and asymmetry analysis adjusted for the low number of studies (an Egger’s regression test and a three-parameter selection model where two tailed p < 0.05 was considered statistically significant). The I2 test was conducted to analyze the heterogeneity between studies: an I2 >50% indicated a between-study heterogeneity. Statistical analyses were performed with R: R-4.1.2 for Windows 10 (32/64 bit) released 2021-11-01 and R studio desktop RStudio Desktop 1.4.1717 for Windows 10 64 bit (R Foundation for Statistical Computing, Vienna, Austria, URL https://www.R-project.org/). Results Study Selection The study selection process for acromegaly is depicted in Figure 2. The electronic search revealed 179 articles, with one duplicate (N = 178). After the first screening, 141 articles did not meet the eligibility criteria and were discarded. The full-text examination of the remaining studies excluded additional 31 articles: 27 did not provide adequate data about tumor size, two represented the core phase of an extension study, another one referred to a subset of patients from a larger study, and the last one did not provide sufficient data about the percentage of tumor size reduction. Thus, six studies fulfilling eligibility criteria (reported in Tables 1, 2), were selected for data extraction and analysis. Figure 2 FIGURE 2 Search strategy for acromegaly. * Petersenn S, 2010 (PAS sc, phase II) and Colao A, 2014 (PAS LAR). ** Shimon I, 2015 (PAS LAR). *** Tahara S, 2019 (PAS LAR, phase II). PAS, pasireotide, sc, subcutaneous, LAR, long-acting release. Table 1 TABLE 1 Studies considered for the metanalysis in acromegaly. Table 2 TABLE 2 Studies considered for the metanalysis in acromegaly. The study selection process for CD is depicted in Figure 3. The electronic search revealed 122 articles; an additional one had been included post-hoc, through reference analysis of selected articles (N = 123). After the first screening, 91 articles did not meet the eligibility criteria and were discarded. The full-text examination of the remaining studies excluded 29 more articles: 23 did not provide sufficient data on tumor shrinkage, two of them represented the core phase of extension studies, two referred to subsets of patients included in a larger study and two did not provide sufficient data regarding the percentage of tumor size reduction. Thus, three studies fulfilling eligibility criteria (reported in Tables 3, 4) were selected for data extraction and analysis. Figure 3 FIGURE 3 Search strategy for Cushing’s Disease. * Lacroix A, 2018 (PAS LAR, phase III) and Lacroix A, 2020 (PAS sc, phase III post-hoc analysis). ** Simeoli C, 2014 (PAS sc) and Colao A 2012 (PAS sc, phase III). *** Daniel E, 2018 (PAS sc and LAR) and Trementino L, 2016 (PAS sc). PAS, pasireotide, sc, subcutaneous, LAR, long acting release. Table 3 TABLE 3 Studies considered for the metanalysis in Cushing’s Disease. Table 4 TABLE 4 Studies considered for the metanalysis in Cushing’s Disease. Study Characteristics Four multi- and two mono-centric studies in patients with acromegaly were considered and analyzed, all presenting a prospective design. Tumor size analysis was not one of the primary endpoints in any of the considered studies; from an initial overall recruitment of 358 patients, only 265 were included for tumor size reduction analysis. Most patients had previously undergone different treatments (Table 1). All studies, except one, used PAS LAR, dose titration was allowed in all trials. Median follow-up ranged from 6 to 25 months; MRI was performed to evaluate tumor size reduction and the criteria for considering it significant was mainly based on tumor volume analysis, except for Lasolle H et al. which considered median height reduction (26). Data from the PAOLA study provided separate percentages of significant tumor shrinkage for PAS at 40 mg or 60 mg once monthly; considering that respectively 12 and 7 patients showed a reduction >25%, a significant shrinkage was reported in 19 out of 79 considered cases (24%) (4). Stelmachowska-Banás et al. described one patient with McCune-Albright’s syndrome presenting with pituitary hyperplasia, without a visible adenoma at MRI; as its pituitary volume decreased during treatment, the patient was included in the group with significant tumor shrinkage (27). No study provided information about macro- to micro-adenoma ratio. Data regarding age and male to female ratio are also reported in Table 2. Three studies including patients with CD met the eligibility criteria (Tables 3, 4); all of them presented a multicentre prospective design, recruiting 139 patients, most of them assuming PAS as a second-line treatment, after a surgical failure. For tumor shrinkage analysis, a subgroup of 34 patients was considered, taking s.c. PAS bis-in-die in two studies and PAS LAR in the third; in all cases titration was admitted. Tumor size analysis was a secondary endpoint in all three studies. Follow-up ranged from 6 to 60 months; tumor size assessment was performed with pituitary MRI. Only Pivonello et al. evaluated maximum diameter, instead of tumor volume changes (28). The population analyzed for tumor shrinkage mainly presented with a microadenoma. Data regarding age and gender are reported in Table 4. In the trial reported by Petersenn S et al., we arbitrarily fixed the criterion to define a significant tumor volume reduction (at least 25% of the baseline size of the pituitary adenoma), and the proportion of responders was calculated from the supplementary materials accordingly (3/6 = 50%) (13). Pivonello et al. separated patients exhibiting mild-moderate from those with severe hypercortisolism; we considered them together for tumor size analysis obtaining an overall proportion of significant size reduction of 21.4% (3 out of 14 subjects) (28). Risk of Bias The evaluation of the risk of bias performed with the adapted JBI tool is reported in Table 5. All studies presented clear diagnostic and inclusion criteria, except that of Lasolle H et al. (26). Although all papers reported a valid tool for tumor shrinkage analysis (MRI), two of them did not analyse tumor volume and did not provide a clear definition of significant size reduction (26, 28). Regarding other items, the majority of the considered studies did not appear to present a clear source of bias. Table 5 TABLE 5 Evaluation of the risk of bias performed with the adapted Joanna Briggs’s Institute (JBI) tool. Meta-Analysis In the six studies considered for acromegaly, 37.7% (95%CI: [18.7%; 61.5%]) of patients demonstrated a significant tumor size reduction (Figure 4). As expected, heterogeneity in tumor reduction between studies was high (I2 = 90%). We attempted to address publication bias despite the low-number of studies (Figure 6A😞 Egger’s regression test did not indicate the presence of funnel plot asymmetry (intercept = -3.15 with 95%CI: [-10.17; 3.85], t = -0.883, p = 0.427) and the three-parameter selection model performed for p < 0.05 (and p < 0.1 as a sensitivity analysis) suggested absence of publication bias (28). Figure 4 FIGURE 4 Pooled effect for the proportion of responders (i.e. presenting significant tumor shrinkage) in acromegaly. CI, confidence interval. In the three studies considered for CD, 41,2% (95%CI: [22.9%; 62.3%]) of patients overall demonstrated a significant tumor size reduction (Figure 5). The heterogeneity in tumor reduction between the studies represented by I2 amounted to 47%. Publication bias analysis (Figure 6B) was performed using Egger’s regression test (intercept = -1.828 with 95%CI: [-14.53; 10.88], t = -0.282, p = 0.825) without evidence of asymmetry. The three-parameter selection model on the contrary could not be performed due to the small number of studies. Figure 5 FIGURE 5 Pooled effect for the proportion of responders (i.e. presenting significant tumor shrinkage) in Cushing’s Disease. CI, confidence interval. Figure 6 FIGURE 6 (A) Funnel plot assessing publication bias for Acromegaly. (B) Funnel plot assessing publication bias for Cushing’s Disease. Discussion The biochemical efficacy of medical treatment with PAS in GH- or ACTH-secreting pituitary adenomas has been described in previous metanalyses for acromegaly (29, 30) and CD (15), the latter also exploring the clinical benefit. In addition to these reports, this meta-analysis shows that PAS treatment can induce an additional clinically significant tumor shrinkage in approximately 40% of patients. Acromegaly Overall, PAS treatment provided tumor shrinkage in 37.7% of the considered patients. A previous metanalysis on octreotide in acromegaly provided a higher percentage of tumor size reduction (over 50%) (20). Nevertheless, since PAS treatment is usually considered as a second- or third-line treatment in the therapeutic flow-chart of acromegaly, the population recruited is mainly composed of patients with first-generation SRL-resistant somatotroph adenomas. This bias in recruited populations of acromegalic patients may explain this difference in the outcome. In a direct comparison, although PAS LAR seemed more effective in achieving biochemical control, both the SRLs, the first- and the second-generation types, achieved similar percentages of tumor shrinkage (6, 7). Moreover, in the crossover extension, the switch from octreotide to PAS was more effective than the reverse schedule, achieving a slightly higher percentage of further significant tumor shrinkage (8). Lasolle et al. reported that the expression of SSR type 5 and the granulation pattern are of limited value for the prediction of PAS responsiveness: 5 out of 9 somatotropinomas in their series were densely granulated (two did not respond to PAS), and the expression of SSR type 5 was modest in one controlled patient (26). Other than SRLs, a further therapeutic option targeting the somatotroph adenoma is cabergoline, either as monotherapy in mild cases or as an add-on treatment for resistant adenomas (18). In a previous metanalysis, cabergoline in monotherapy resulted less effective than SRLs, achieving tumor shrinkage in about one third of the enrolled patients (31). It should also be mentioned that some studies reported an escape phenomenon from its treatment efficacy (32). Data coming from the combination of PAS LAR and pegvisomant in acromegaly were not considered in our metanalysis, due to inclusion criteria and variable combination therapy of the two drugs (33). Since some cases of adenoma growth had been reported during pegvisomant use (34, 35), this combination therapy represents a rational approach, but tumor volume analysis is less reliable, given the purpose of our study. Despite concerns regarding tumor growth, pegvisomant effectiveness in acromegaly is well documented (18, 29), although the cost of this combination treatment can limit its applicability in real-life practice. Moreover, it is worth mentioning Coopmans and collaborators’ follow-up analysis, suggesting a PAS mediated anti-tumoral effect in acromegaly. During treatment, patients exhibited a significant increase in T2-weighted sequences signal at MRI; moreover, patients exhibiting this MRI characteristic in their adenomas showed a more evident decrease in IGF-1 levels, but not a similar pattern in reduction of pituitary adenoma size (36). This finding may be related to cell degeneration or tumor cell necrosis, without necessarily determining significant tumor size reduction. Further studies, probably with more data coming from histological reports, may be necessary to better understand these findings. Cushing’s Disease Overall, PAS treatment provided significant tumor shrinkage in 41.2% of CD patients. Regarding pituitary-directed drugs, at this moment available for CD treatment, the efficacy of cabergoline has been proven in vitro studies, but its efficacy in clinical trials is still debated (15, 37). In a previous prospective study, cabergoline induced significant tumor shrinkage (defined as tumor volume reduction >20%) in 4 out of 20 (20%) of the patients recruited after 24 months (38). PAS is the only pituitary-directed treatment for this condition approved by Drug Agencies. Although few studies have been considered in this metanalysis, due to the strict inclusion criteria, PAS appears more effective in tumor size reduction versus cabergoline, resulting in a better choice in CD therapy when aiming to control the pituitary adenoma. In contrast to acromegaly, the majority of CD patients present a microadenoma, suggesting that tumor size might be a less relevant issue during medical treatment, even if the “cure” of the disease may forecast the resolution of the adenoma. Besides, up to 30% of CD patients, depending also on MRI accuracy and neuro-radiologist’s expertise, may present with negative imaging that prevents any evaluation of tumor shrinkage (39). In spite of that, endocrinologists, not so infrequently, deal with aggressive corticotroph adenomas, characterized by invasive local growth and/or resistance to conventional therapies. This challenging entity often requires multidisciplinary expertise to suggest different approaches, including PAS treatment (40). It should be mentioned that some non-pituitary targeting drugs, as inhibitors of cortisol synthesis, have been associated with tumor growth, due to cortisol-ACTH negative feedback. In particular, during osilodrostat treatment in a phase III study, four recruited patients discontinued osilodrostat after a significant increase in tumor volume (two with micro- and two with macro-adenomas 41), and this growth had also been described during ketoconazole and mitotane treatments (42). Thus, it may be speculated that PAS could provide a rational approach as an combination treatment with steroidogenesis inhibitors. Moreover, after bilateral adrenalectomy, pituitary adenoma tumor size is of the utmost importance, as patients may be at risk of developing a progression of the adenoma, the so-called Nelson’s syndrome. In a prospective study from Daniel E et al., PAS proved to be also effective in this setting, reducing ACTH levels and stabilizing the residual tumor over a treatment period of 7 months (43). Further studies, with longer treatment observation, may reveal whether PAS may achieve significant tumor shrinkage in these patients, as suggested by previous case reports in literature (44, 45). Conclusion The main limitation of our study resides in the scarce literature provided up to now (260 patients with acromegaly and 34 with CD), in the different therapy schedules and different criteria for tumor shrinkage in the selected study (largest tumor diameter vs a selected percentage of reduction). Moreover, in none of the study tumor reduction was one of the primary endpoints, and surgery was performed before PAS in most patients (78-88% of CD and 43-96% of acromegaly). PAS is a novel compound, with a rising role in the treatment of secreting pituitary adenomas. Thus, this topic might be amplified with more data coming from further clinical studies, as real-life studies, possibly also addressing markers predictive of response to this treatment (e.g., expression of SSR type 2 and type 5 or somatic mutations in USP8 at tissue level of ACTH-secreting adenomas). Nevertheless, we can already state that PAS treatment is effective in reducing tumor size, especially in acromegaly. Our results strengthen the role of PAS treatment in somatotroph and corticotroph adenomas, especially when tumor volume is a relevant issue (i.e. tumor progression, extrasellar invasion) (18, 39), as a neoadjuvant treatment before surgery or as tailored treatment, alone or in combination, in persistent disease or when surgery is not feasible. Future research aiming to characterize markers predictive of response could help to identify optimal candidates for this treatment. Data Availability Statement The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding author. Ethics Statement Informed consent was obtained from all subjects participating in the studies analyzed. Author Contributions Authors involved contributed to research as reported: literature search (FC, AM), preparation of original draft (FC, AM, MB, LD), literature review (CS, FC, AM, MF), manuscript editing (CS, FC, AM, MB, LD, MF) and supervision (RM, CS). All authors approved the final version of the paper. Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher’s Note All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. References 1. Chinezu L, Vasiljevic A, Jouanneau E, François P, Borda A, Trouillas J, et al. Expression of Somatostatin Receptors, SSTR2A and SSTR5, in 108 Endocrine Pituitary Tumors Using Immunohistochemical Detection With New Specific Monoclonal Antibodies. Hum Pathol (2014) 45(1):71–7. doi: 10.1016/j.humpath.2013.08.007 PubMed Abstract | CrossRef Full Text | Google Scholar 2. Ceccato F, Scaroni C, Boscaro M. Clinical Use of Pasireotide for Cushing's Disease in Adults. Ther Clin Risk Manage (2015) 11:425–34. doi: 10.2147/TCRM.S37314 CrossRef Full Text | Google Scholar 3. Melmed S, Colao A, Barkan A, Molitch M, Grossman AB, Kleinberg D, et al. Guidelines for Acromegaly Management: An Update. J Clin Endocrinol Metab (2009) 94(5):1509–17. doi: 10.1210/jc.2008-2421 PubMed Abstract | CrossRef Full Text | Google Scholar 4. Gadelha MR, Bronstein MD, Brue T, Coculescu M, Fleseriu M, Guitelman M, et al. Pasireotide Versus Continued Treatment With Octreotide or Lanreotide in Patients With Inadequately Controlled Acromegaly (PAOLA): A Randomised, Phase 3 Trial. Lancet Diabetes Endocrinol (2014) 2(11):875–84. doi: 10.1016/S2213-8587(14)70169-X PubMed Abstract | CrossRef Full Text | Google Scholar 5. Colao A, Bronstein MD, Brue T, De Marinis L, Fleseriu M, Guitelman M, et al. Pasireotide for Acromegaly: Long-Term Outcomes From an Extension to the Phase III PAOLA Study. Eur J Endocrinol (2020) 182(6):583. doi: 10.1530/EJE-19-0762 PubMed Abstract | CrossRef Full Text | Google Scholar 6. Colao A, Bronstein MD, Freda P, Gu F, Shen CC, Gadelha M, et al. Pasireotide Versus Octreotide in Acromegaly: A Head-to-Head Superiority Study. J Clin Endocrinol Metab (2014) 99(3):791–9. doi: 10.1210/jc.2013-2480 PubMed Abstract | CrossRef Full Text | Google Scholar 7. Sheppard M, Bronstein MD, Freda P, Serri O, De Marinis L, Naves L, et al. Pasireotide LAR Maintains Inhibition of GH and IGF-1 in Patients With Acromegaly for Up to 25 Months: Results From the Blinded Extension Phase of a Randomized, Double-Blind, Multicenter, Phase III Study. [Published Correction Appears in Pituitary]. (2015) 18(3):385–94. doi: 10.1007/s11102-014-0585-6 CrossRef Full Text | Google Scholar 8. Bronstein MD, Fleseriu M, Neggers S, Colao A, Sheppard M, Gu F, et al. Switching Patients With Acromegaly From Octreotide to Pasireotide Improves Biochemical Control: Crossover Extension to a Randomized, Double-Blind, Phase III Study. BMC Endocr Disord (2016) 16:16. doi: 10.1186/s12902-016-0096-8 PubMed Abstract | CrossRef Full Text | Google Scholar 9. Gadelha M, Bex M, Colao A, Pedroza García EM, Poiana C, Jimenez-Sanchez M, et al. Evaluation of the Efficacy and Safety of Switching to Pasireotide in Patients With Acromegaly Inadequately Controlled With First-Generation Somatostatin Analogs. Front Endocrinol (Lausanne). (2020) 10:931. doi: 10.3389/fendo.2019.00931 PubMed Abstract | CrossRef Full Text | Google Scholar 10. Colao A, Petersenn S, Newell-Price J, Findling JW, Gu F, Maldonado M, et al. A 12-Month Phase 3 Study of Pasireotide in Cushing's Disease. N Engl J Med (2012) 366(10):914–24. doi: 10.1056/NEJMoa1105743 PubMed Abstract | CrossRef Full Text | Google Scholar 11. Pivonello R, Petersenn S, Newell-Price J, Findling JW, Gu F, Maldonado M, et al. Pasireotide Treatment Significantly Improves Clinical Signs and Symptoms in Patients With Cushing's Disease: Results From a Phase III Study. Clin Endocrinol (Oxf). (2014) 81(3):408–17. doi: 10.1111/cen.12431 PubMed Abstract | CrossRef Full Text | Google Scholar 12. Lacroix A, Gu F, Gallardo W, Pivonello R, Yu Y, Witek P, et al. Efficacy and Safety of Once-Monthly Pasireotide in Cushing's Disease: A 12 Month Clinical Trial. Lancet Diabetes Endocrinol (2018) 6(1):17–26. doi: 10.1016/S2213-8587(17)30326-1 PubMed Abstract | CrossRef Full Text | Google Scholar 13. Petersenn S, Salgado LR, Schopohl J, Portocarrero-Ortiz L, Arnaldi G, Lacroix A, et al. Long-Term Treatment of Cushing's Disease With Pasireotide: 5-Year Results From an Open-Label Extension Study of a Phase III Trial. Endocrine. (2017) 57(1):156–65. doi: 10.1007/s12020-017-1316-3 PubMed Abstract | CrossRef Full Text | Google Scholar 14. Fleseriu M, Petersenn S, Biller BMK, Kadioglu P, De Block C, T'Sjoen G, et al. Long-Term Efficacy and Safety of Once-Monthly Pasireotide in Cushing's Disease: A Phase III Extension Study. Clin Endocrinol (Oxf). (2019) 91(6):776–85. doi: 10.1111/cen.14081 PubMed Abstract | CrossRef Full Text | Google Scholar 15. Simões Corrêa Galendi J, Correa Neto ANS, Demetres M, Boguszewski CL, Nogueira VDSN. Effectiveness of Medical Treatment of Cushing's Disease: A Systematic Review and Meta-Analysis. Front Endocrinol (Lausanne). (2021) 12:732240. doi: 10.3389/fendo.2021.732240 PubMed Abstract | CrossRef Full Text | Google Scholar 16. Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, et al. The USP8 Mutational Status may Predict Drug Susceptibility in Corticotroph Adenomas of Cushing's Disease. Eur J Endocrinol (2016) 174(2):213–26. doi: 10.1530/EJE-15-0689 PubMed Abstract | CrossRef Full Text | Google Scholar 17. Samson SL, Gu F, Feldt-Rasmussen U, Zhang S, Yu Y, Witek P, et al. Managing Pasireotide-Associated Hyperglycemia: A Randomized, Open-Label, Phase IV Study. Pituitary. (2021) 24(6):887–903. doi: 10.1007/s11102-021-01161-4 PubMed Abstract | CrossRef Full Text | Google Scholar 18. Katznelson L, Laws ER Jr, Melmed S, Molitch ME, Murad MH, Utz A, et al. Acromegaly: An Endocrine Society Clinical Practice Guideline. J Clin Endocrinol Metab (2014) 99(11):3933–51. doi: 10.1210/jc.2014-2700 PubMed Abstract | CrossRef Full Text | Google Scholar 19. Cozzi R, Montini M, Attanasio R, Albizzi M, Lasio G, Lodrini S, et al. Primary Treatment of Acromegaly With Octreotide LAR: A Long-Term (Up to Nine Years) Prospective Study of its Efficacy in the Control of Disease Activity and Tumor Shrinkage. J Clin Endocrinol Metab (2006) 91(4):1397–403. doi: 10.1210/jc.2005-2347 PubMed Abstract | CrossRef Full Text | Google Scholar 20. Giustina A, Mazziotti G, Torri V, Spinello M, Floriani I, Melmed S. Meta-Analysis on the Effects of Octreotide on Tumor Mass in Acromegaly. PloS One (2012) 7(5):e36411. doi: 10.1371/journal.pone.0036411 PubMed Abstract | CrossRef Full Text | Google Scholar 21. Caron PJ, Bevan JS, Petersenn S, Flanagan D, Tabarin A, Prévost G, et al. Tumor Shrinkage With Lanreotide Autogel 120 Mg as Primary Therapy in Acromegaly: Results of a Prospective Multicenter Clinical Trial. J Clin Endocrinol Metab (2014) 99(4):1282–90. doi: 10.1210/jc.2013-3318 PubMed Abstract | CrossRef Full Text | Google Scholar 22. Potorac I, Petrossians P, Daly AF, Alexopoulou O, Borot S, Sahnoun-Fathallah M, et al. T2-Weighted MRI Signal Predicts Hormone and Tumor Responses to Somatostatin Analogs in Acromegaly. Endocr Relat Cancer. (2016) 23(11):871–81. doi: 10.1530/ERC-16-0356 PubMed Abstract | CrossRef Full Text | Google Scholar 23. Schardt C, Adams MB, Owens T, Keitz S, Fontelo P. Utilization of the PICO Framework to Improve Searching PubMed for Clinical Questions. BMC Med Inform Decis Mak. (2007) 7:16. doi: 10.1186/1472-6947-7-16 PubMed Abstract | CrossRef Full Text | Google Scholar 24. McInnes MDF, Moher D, Thombs BD, McGrath TA, Bossuyt PM. Preferred Reporting Items for a Systematic Review and Meta-Analysis of Diagnostic Test Accuracy Studies: The PRISMA-DTA Statement [Published Correction Appears in JAMA. 2019 Nov 26;322(20):2026]. JAMA. (2018) 319(4):388–96. doi: 10.1001/jama.2017.19163 CrossRef Full Text | Google Scholar 25. Munn Z, Barker TH, Moola S, Tufanaru C, Stern C, McArthur A, et al. Methodological Quality of Case Series Studies: An Introduction to the JBI Critical Appraisal Tool. JBI Evid Synth. (2020) 18(10):2127–33. doi: 10.11124/JBISRIR-D-19-00099 PubMed Abstract | CrossRef Full Text | Google Scholar 26. Lasolle H, Ferriere A, Vasiljevic A, Eimer S, Nunes ML, Tabarin A. Pasireotide-LAR in Acromegaly Patients Treated With a Combination Therapy: A Real-Life Study. Endocr Connect. (2019) 8(10):1383–94. doi: 10.1530/EC-19-0332 PubMed Abstract | CrossRef Full Text | Google Scholar 27. Stelmachowska-Banaś M, Czajka-Oraniec I, Tomasik A, Zgliczyński W. Real-World Experience With Pasireotide-LAR in Resistant Acromegaly: A Single Center 1-Year Observation. Pituitary. (2022) 25(1):180–90. doi: 10.1007/s11102-021-01185-w PubMed Abstract | CrossRef Full Text | Google Scholar 28. Pivonello R, Arnaldi G, Scaroni C, Giordano C, Cannavò S, Iacuaniello D, et al. The Medical Treatment With Pasireotide in Cushing's Disease: An Italian Multicentre Experience Based on "Real-World Evidence". Endocrine. (2019) 64(3):657–72. doi: 10.1007/s12020-018-1818-7 PubMed Abstract | CrossRef Full Text | Google Scholar 29. Leonart LP, Ferreira VL, Tonin FS, Fernandez-Llimos F, Pontarolo R. Medical Treatments for Acromegaly: A Systematic Review and Network Meta-Analysis. Value Health (2018) 21(7):874–80. doi: 10.1016/j.jval.2017.12.014” PubMed Abstract | CrossRef Full Text | Google Scholar 30. Qiao N, He M, Shen M, Zhang Q, Zhang Z, Shou X, et al. Comparative Efficacy Of Medical Treatment For Acromegaly: A Systematic Review And Network Meta-Analysis Of Integrated Randomized Trials And Observational Studies. Endocr Pract (2020) 26(4):454–62. doi: 10.4158/EP-2019-0528 PubMed Abstract | CrossRef Full Text | Google Scholar 31. Sandret L, Maison P, Chanson P. Place of Cabergoline in Acromegaly: A Meta-Analysis. J Clin Endocrinol Metab (2011) 96(5):1327–35. doi: 10.1210/jc.2010-2443 PubMed Abstract | CrossRef Full Text | Google Scholar 32. Giraldi EA, Ioachimescu AG. The Role of Dopamine Agonists in Pituitary Adenomas. Endocrinol Metab Clin North Am (2020) 49(3):453–74. doi: 10.1016/j.ecl.2020.05.006 PubMed Abstract | CrossRef Full Text | Google Scholar 33. Muhammad A, van der Lely AJ, Delhanty PJD, Dallenga AHG, Haitsma IK, Janssen JAMJL, et al. Efficacy and Safety of Switching to Pasireotide in Patients With Acromegaly Controlled With Pegvisomant and First-Generation Somatostatin Analogues (PAPE Study). J Clin Endocrinol Metab (2018) 103(2):586–95. doi: 10.1210/jc.2017-02017 PubMed Abstract | CrossRef Full Text | Google Scholar 34. uhk JH, Jung S, Psychogios MN, Göricke S, Hartz S, Schulz-Heise S, et al. Tumor Volume of Growth Hormone-Secreting Pituitary Adenomas During Treatment With Pegvisomant: A Prospective Multicenter Study. J Clin Endocrinol Metab (2010) 95(2):552–8. doi: 10.1210/jc.2009-1239 PubMed Abstract | CrossRef Full Text | Google Scholar 35. Marazuela M, Paniagua AE, Gahete MD, Lucas T, Alvarez-Escolá C, Manzanares R, et al. Somatotroph Tumor Progression During Pegvisomant Therapy: A Clinical and Molecular Study. J Clin Endocrinol Metab (2011) 96(2):E251–9. doi: 10.1210/jc.2010-1742 PubMed Abstract | CrossRef Full Text | Google Scholar 36. Coopmans EC, van der Lely AJ, Schneiders JJ, Neggers SJCMM. Potential Antitumour Activity of Pasireotide on Pituitary Tumours in Acromegaly. Lancet Diabetes Endocrinol (2019) 7(6):425–6. doi: 10.1016/S2213-8587(19)30113-5 PubMed Abstract | CrossRef Full Text | Google Scholar 37. Ferriere A, Cortet C, Chanson P, Delemer B, Caron P, Chabre O, et al. Cabergoline for Cushing's Disease: A Large Retrospective Multicenter Study. Eur J Endocrinol (2017) 176(3):305–14. doi: 10.1530/EJE-16-0662 PubMed Abstract | CrossRef Full Text | Google Scholar 38. Pivonello R, De Martino MC, Cappabianca P, De Leo M, Faggiano A, Lombardi G, et al. The Medical Treatment of Cushing's Disease: Effectiveness of Chronic Treatment With the Dopamine Agonist Cabergoline in Patients Unsuccessfully Treated by Surgery. J Clin Endocrinol Metab (2009) 94(1):223–30. doi: 10.1210/jc.2008-1533 PubMed Abstract | CrossRef Full Text | Google Scholar 39. Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR, et al. Consensus on Diagnosis and Management of Cushing's Disease: A Guideline Update. Lancet Diabetes Endocrinol (2021) 9(12):847–75. doi: 10.1016/S2213-8587(21)00235-7 PubMed Abstract | CrossRef Full Text | Google Scholar 40. Ceccato F, Lombardi G, Manara R, Emanuelli E, Denaro L, Milanese L, et al. Temozolomide and Pasireotide Treatment for Aggressive Pituitary Adenoma: Expertise at a Tertiary Care Center. J Neurooncol. (2015) 122(1):189–96. doi: 10.1007/s11060-014-1702-0 PubMed Abstract | CrossRef Full Text | Google Scholar 41. Pivonello R, Fleseriu M, Newell-Price J, Bertagna X, Findling J, Shimatsu A, et al. Efficacy and Safety of Osilodrostat in Patients With Cushing's Disease (LINC 3): A Multicentre Phase III Study With a Double-Blind, Randomised Withdrawal Phase. Lancet Diabetes Endocrinol (2020) 8(9):748–61. doi: 10.1016/S2213-8587(20)30240-0 PubMed Abstract | CrossRef Full Text | Google Scholar 42. Varlamov EV, Han AJ, Fleseriu M. Updates in Adrenal Steroidogenesis Inhibitors for Cushing's Syndrome - A Practical Guide. Best Pract Res Clin Endocrinol Metab (2021) 35(1):101490. doi: 10.1016/j.beem.2021.101490 PubMed Abstract | CrossRef Full Text | Google Scholar 43. Daniel E, Debono M, Caunt S, Girio-Fragkoulakis C, Walters SJ, Akker SA, et al. A Prospective Longitudinal Study of Pasireotide in Nelson's Syndrome. Pituitary. (2018) 21(3):247–55. doi: 10.1007/s11102-017-0853-3 PubMed Abstract | CrossRef Full Text | Google Scholar 44. Katznelson L. Sustained Improvements in Plasma ACTH and Clinical Status in a Patient With Nelson's Syndrome Treated With Pasireotide LAR, a Multireceptor Somatostatin Analog. J Clin Endocrinol Metab (2013) 98(5):1803–7. doi: 10.1210/jc.2013-1497 PubMed Abstract | CrossRef Full Text | Google Scholar 45. He X, Spencer-Segal JL. Rapid Response of Nelson's Syndrome to Pasireotide in Radiotherapy-Naive Patient. Clin Diabetes Endocrinol (2020) 6(1):22. doi: 10.1186/s40842-020-00110-7 PubMed Abstract | CrossRef Full Text | Google Scholar Keywords: pasireotide, cushing, acromegaly, tumor volume, tumor size Citation: Mondin A, Manara R, Voltan G, Tizianel I, Denaro L, Ferrari M, Barbot M, Scaroni C and Ceccato F (2022) Pasireotide-Induced Shrinkage in GH and ACTH Secreting Pituitary Adenoma: A Systematic Review and Meta-Analysis. Front. Endocrinol. 13:935759. doi: 10.3389/fendo.2022.935759 Received: 04 May 2022; Accepted: 06 June 2022; Published: 01 July 2022. Edited by: Mohammad E. Khamseh, Iran University of Medical Sciences, Iran Reviewed by: Rosa Paragliola, Catholic University of the Sacred Heart, Rome, Italy Marek Bolanowski, Wroclaw Medical University, Poland Adriana G Ioachimescu, Emory University, United States Copyright © 2022 Mondin, Manara, Voltan, Tizianel, Denaro, Ferrari, Barbot, Scaroni and Ceccato. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. *Correspondence: Filippo Ceccato, filippo.ceccato@unipd.it †ORCID: Alessandro Mondin, orcid.org/0000-0002-6046-5198 Renzo Manara, orcid.org/0000-0002-5130-3971 Giacomo Voltan, orcid.org/0000-0002-3628-0492 Irene Tizianel, orcid.org/0000-0003-4092-5107 Luca Denaro, orcid.org/0000-0002-2529-6149 Marco Ferrari, orcid.org/0000-0002-4023-0121 Mattia Barbot, orcid.org/0000-0002-1081-5727 Carla Scaroni, orcid.org/0000-0001-9396-3815 Filippo Ceccato, orcid.org/0000-0003-1456-8716 Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. From https://www.frontiersin.org/articles/10.3389/fendo.2022.935759/full
  18. Abstract Although human cultures stimulated with dexamethasone suggest that the glucocorticoid receptor (GR) activates stress erythropoiesis, the effects of GR activation on erythropoiesis in vivo remains poorly understood. We characterized the phenotype of a large cohort of patients with Cushing’s Disease, a rare condition associated with elevated cortisol levels. Results from hypercortisolemic patients with active Cushing’s were compared with those obtained from eucortisolemic patients after remission and from non-diseased volunteers. Active Cushing’s patients exhibit erythrocytosis associated with normal hemoglobin F levels. In addition, their blood contained elevated numbers of the GR-induced CD163+ monocytes and a unique class of CD34+ cells expressing CD110, CD36, CD133 and the GR-target gene CXCR4. When cultured, these CD34+ cells generated similarly large numbers of immature erythroid cells in the presence and absence of dexamethasone, with raised expression of the GR-target gene GILZ. Of interest, blood from Cushing’s patients in remission maintained high numbers of CD163+ monocytes and, although their CD34+ cells had a normal phenotype, these cells were unresponsive to added dexamethasone. Collectively, these results indicate that chronic exposure to excess glucocorticoids in vivo leads to erythrocytosis by generating erythroid progenitor cells with a constitutively active GR. Although remission rescues the erythrocytosis and the phenotype of the circulating CD34+ cells, a memory of other prior changes is maintained in remission. From https://haematologica.org/article/view/haematol.2021.280542
  19. Journal of the Endocrine Society, Volume 6, Issue 7, July 2022, bvac080, https://doi.org/10.1210/jendso/bvac080 Abstract Context Subclinical pituitary hemorrhage, necrosis, and/or cystic degeneration (SPH) presents mainly in large tumors and prolactinomas. The characteristics of patients with Cushing disease (CD) and SPH are not known. Objective To determine if SPH affects the presentation and biochemical profile of young patients with CD. Methods Pediatric and adolescent patients who were diagnosed with CD between 2005 and 2021 and available magnetic resonance imaging images were evaluated for SPH. The clinical and biochemical characteristics of patients with and without SPH were compared. Results Evidence of possible SPH was present in 12 out of 170 imaging studies (7.1%). Patients with and without SPH had similar age at diagnosis and sex distribution but differed in disease duration (median duration: 1.0 year [1.0-2.0] in the SPH group vs 2.5 years [1.5-3.0] in the non-SPH group, P = .014). When comparing their biochemical evaluation, patients with SPH had higher levels of morning adrenocorticotropin (ACTH) (60.8 pg/mL [43.5-80.3]) compared to patients without SPH (39.4 pg/mL [28.2-53.2], P = .016) and the degree of cortisol reduction after overnight high dose (8 mg or weight-based equivalent) dexamethasone was lower (–58.0% [–85.4 to –49.7]) compared to patients without SPH (85.8 [–90.5 to –76.8], P = .035). The presence of SPH did not affect the odds of remission after surgery or the risk of recurrence after initial remission. Conclusion SPH in ACTH-secreting pituitary adenomas may affect their biochemical response during endocrine evaluations. They may, for example, fail to suppress to dexamethasone which can complicate diagnosis. Thus, SPH should be mentioned on imaging and taken into consideration in the work up of pediatric patients with CD. Cushing, subclinical pituitary hemorrhage, pituitary tumor, dexamethasone, pituitary MRI Issue Section: Clinical Research Article Acute hemorrhage or necrosis of pituitary adenomas (PAs), defined as pituitary apoplexy, is a rare life-threatening condition that requires emergent neurosurgical evaluation [1]. However, subclinical hemorrhage, necrosis, intratumor cystic degeneration, and/or infarct of PAs, herein all events included in the term subclinical pituitary hemorrhage (SPH) for brevity, may occur in up to 7% to 22% of all pituitary tumors [2-9]. SPH is not associated with significant clinical symptoms and is often discovered at the time of routine diagnostic evaluation [2-9]. Previous studies suggested that SPH is more common in large tumors, prolactin-secreting or nonfunctioning PAs, while other factors, such as initiation or withdrawal of treatment with dopamine agonists, use of anticoagulants and others, have also been hypothesized to be involved in this process [5, 6]. Overall, adrenocorticotropin (ACTH)-secreting PAs represent small percentage of SPH (0%-3.2% of cases reported) [3, 5, 6, 8]. Although pituitary apoplexy is associated with pituitary hormone deficiencies, SPH has a lower if any effect on the function of the remaining pituitary gland when it occurs in nonfunctioning adenomas [3, 4]. The diagnosis of Cushing syndrome (CS) involves elaborate and time-dependent tests that are based on cortisol secretion and its regulation by ACTH [10]. Furthermore, the differential diagnosis of ACTH-dependent causes between ACTH-secreting PAs (Cushing disease, CD) and ectopic ACTH secretion is based on several dynamic tests, such as corticotropin-releasing hormone (CRH) stimulation and dexamethasone suppression [11]. The biochemical profile of corticotropinomas with SPH to both baseline and dynamic endocrine tests is not known. Materials and Methods Participants Individuals enrolled under the protocol 97-CH-0076 (ClinicalTrials.gov identifier NCT00001595) at the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD), from 2005 to 2020 with confirmed diagnosis of CD, were screened for eligibility in the study. Pediatric and adolescent patients (diagnosis age < 21 years) with imaging studies available before any surgical intervention were included in the analysis. Patients with previous surgery of the pituitary gland or who were evaluated during recurrence were excluded from the study since postoperative changes make imaging findings difficult to distinguish from true SPH, and biochemical presentation at recurrence often differs in severity from initial diagnosis. CS diagnosis was based on criteria defined by the Endocrine Society guidelines and adjusted for the pediatric and adolescent population as needed (abnormal measurements in at least 2 of the following criteria: elevated 24 hour urinary free cortisol [UFC], elevated midnight serum cortisol [> 4.4 mcg/dL in children or > 7.5 mcg/dL for patients age > 18 years], and/or failure to suppress cortisol to 1 mg [or weight-based equivalent dose] overnight dexamethasone suppression test [postdexamethasone cortisol > 1.8 mcg/dL]). CD diagnosis was based on postoperative histologic confirmation of ACTH-secreting PA in most cases, or remission after pituitary surgery even if histologic report failed to identify a PA in the studied material. Remission was defined as postoperative cortisol nadir of less than 2 mcg/dL and/or clinical/biochemical remission during follow-up. Informed consent was obtained from parents and assent from patients if developmentally appropriate. Study procedures were approved by the NICHD and/or central National Institutes of Health Institutional Review Board. Magnetic Resonance Imaging Scans SPH was defined as minimal or no clinical symptoms reported by the patients (apart from those commonly associated with hypercortisolemia) and magnetic resonance imaging (MRI) findings consistent with hemorrhage, intratumor infarction, and/or intratumor cyst formation (suggesting old infarcts) based on the radiologist and the principal investigator’s (C.A.S.) assessment [12, 13]. MRI scans were performed based on standard clinical protocols as previously described [14]. Briefly, MRIs at the National Institutes of Health were performed before and after intravenous administration of gadolinium contrast material, with a gradient echo sequence and thin slices (≤ 1.5 mm). MRIs were performed in either a 1.5 Tesla or 3 Tesla MR machine from various manufacturers over time. Clinical and Biochemical Data Clinical and biochemical data were extracted from electronic medical records. Tumor size was recorded as the maximum dimension retrieved from the histology report. In cases where histologic report was not available, failed to identify a PA in the studied material, or if the histology report recorded only dimensions on fragments of the tumor, the maximum dimension was retrieved from the MRI images. If the MRI was negative and the histology was negative (but the patient achieved remission after surgery), the tumor size was recorded as missing. Serum cortisol and plasma ACTH levels were calculated as the average value of the corresponding levels performed at 23:30 h and 00:00 h (reported as midnight values) and 07:30 h and 08:00 h (reported as morning values). Twenty-four–hour UFC was calculated as the average of the first 2 or 3 samples reported in the electronic medical records. Given the possible differences in the assays and reported reference range for UFC, we calculated the increase of UFC based on the upper limit of normal according to the following formula: UFC fold change = UFC/upper limit of the reference range. Serum cortisol was measured with solid-phase, competitive chemiluminescent enzyme immunoassay on a Siemens Immulite 2500 analyzer. Plasma ACTH was measured with a chemiluminescence immunoassay on a Siemens Immulite 200 XPi analyzer. UFC was measured with a chemiluminescent enzyme immunoassay until 2011 and with high-performance liquid chromatography–tandem mass spectrometry since 2011. High-dose dexamethasone suppression test was performed as previously described. Briefly, oral dexamethasone (120 mcg/kg, max 8 mg) was administered at 23:00 and cortisol was measured before (8 AM the day of administration) and after (9 AM the day after dexamethasone administration). The change of cortisol was calculated as: 100* [(postdexamethasone cortisol – predexamethasone cortisol)/predexamethasone cortisol]. Levels of cortisol lower than the lower limit of detection of the assay (< 1 mcg/dL) were substituted with the intermediate value (0.5) for all analyses. CRH stimulation test was performed as previously described. Briefly, an intravenous catheter was placed in the forearm the night before testing; the patient was fasting and lying in bed, and ovine CRH (oCRH) was administered (1 mcg/kg, max 100 mcg). Samples for cortisol and ACTH were taken at –5, 0, 15, 30, and 45 minutes after the administration of oCRH. The response to the last was expressed as the percentage change from baseline by subtracting the pretest cortisol and ACTH values from the posttest values and dividing by the former. The mean cortisol increase was estimated at 30 and 45 minutes from baseline. For ACTH the mean increase was estimated at 15 and 30 minutes after the administration of oCRH. CRH stimulation test was not performed after the discontinuation of oCRH by the company in November 2020. Statistical Analysis Categorical data are described as counts (proportions) and were compared between groups using the Fisher exact test. Fisher odds ratio (OR) was used to assess the odds of remission based on the presence of SPH and is presented as OR and 95% CI. Continuous data were checked for normality and not normally distributed data are presented as median (first quartile to third quartile) and were compared between 2 groups using Wilcoxon rank-sum test. The Cox proportional hazards test was used to assess the risk of recurrence based on the presence of SPH and is presented as hazard ratio (HR) and 95% CI. Statistical analyses were performed in R. Results Clinical Data Out of 170 patients with available MRI before first surgery, 12 patients had evidence of possible SPH (7.1%) (Table 1). Various MRI findings were noted (Fig. 1), most commonly hyperintense lesions in T1 and T2 precontrast images (Fig. 1A and 1B), while some patients had intratumor heterogeneity suggestive of cystic formation (Fig. 1C-1F). As expected, the tumor size of patients with SPH as noted in histology reports or MRI images was higher than that in patients without SPH (median size: 8.5 mm [7.0-11.25] in the SPH group vs 5.4 mm [4-8] in the non-SPH group; P < .001). Table 1. Characteristics of patients with and without subclinical pituitary hemorrhage, necrosis, and/or cystic degeneration No SPH (N = 158) SPH (N = 12) P Age at diagnosis, y 13.0 (10.6 to 15.4) 12.5 (10.6 to 15.6) .95 Sex  Female 89 (56.3%) 5 (41.7%) .49  Male 69 (43.7%) 7 (58.3%) Disease duration, y 2.50 (1.5 to 3.0) n = 138 1.00 (1.0 to 2.0) n = 10 .014 Morning cortisol, mcg/dL 16.2 (12.6 to 20.4) n = 139 18.4 (13.7 to 27.5) n = 10 .28 Midnight cortisol, mcg/dL 14.0 (10.7 to 19.7) n = 133 16.3 (11.0 to 23.0) n = 9 .52 UFC fold change 4.89 (2.51 to 8.50) n = 131 8.81 (6.86 to 9.42) n = 9 .18 Morning ACTH, pg/mL 39.4 (28.2 to 53.2) n = 143 60.8 (43.5 to 80.3) n = 10 .016 Cortisol change during CRH stimulation test, % 68.7 (33.3 to 111) n = 128 46.0 (–7.46 to 90.7) n = 8 .22 ACTH change during CRH stimulation test, % 145 (59.6 to 260) n = 127 103 (–5.75 to 278) n = 8 .55 Cortisol change during high-dose dexamethasone suppression test, % –85.8 (–90.5 to –76.8) n = 120 –58.0 (–85.4 to –49.7) n = 9 .035 Remission  Yes 127 (80.4%) 10 (83.3%) .99  No 25 (15.8%) 2 (16.7%) Number in each cell reports the number of patients with available results. Abbreviations: ACTH, adrenocorticotropin; CRH, corticotropin-releasing hormone; SPH, subclinical pituitary hemorrhage, necrosis, and/or cystic degeneration; UFC, urinary free cortisol. Open in new tab Figure 1. Open in new tabDownload slide Imaging findings in patients with subclinical pituitary hemorrhage, necrosis, and/or cystic degeneration. A, T1, and B, T2 magnetic resonance imaging (MRI) scans of the same patient showing area of high intensity inside the tumor suggesting acute/subacute episode. C, T2, and D, T1 MRI scans of the same patient showing heterogeneity in a large tumor with high-intensity areas suggesting blood-filled cavities and/or necrosis. E, T1, and F, T2 MRI scans of the same patient showing fluid inside the tumor. Patients with and without SPH were similar in age (median age: 12.5 years [10.6-15.6] in the SPH group vs 13.0 years [10.6-15.4] in the non-SPH group; P = .95) and sex distribution (n of female = 5 (41.7%) in the SPH group vs 89 (56.3%) in the non-SPH group; P = .49). Patients with SPH had a shorter duration of disease as noted by changes in their growth chart parameters (median duration: 1.0 [1.0-2.0] year in the SPH group vs 2.5 [1.5-3.0] years in the non-SPH group; P = .014). Patients in the 2 groups did not differ on their anthropometric characteristics, including height and body mass index z scores(P > .05). They also had similar blood pressure parameters and did not differ in terms of the frequency of hypertension diagnosis. No patient was on anticoagulation treatment nor had received radiation at the time of the MRI. One patient in the SPH group had a history of lower leg deep vein thrombosis and was previously on low-heparin therapy, but he had stopped treatment at least 6 months before the MRI. Biochemical Evaluation of Hypercortisolemia Morning and midnight serum cortisol and 24-hour UFC levels were similar in both groups, but patients with SPH had higher levels of morning ACTH (60.8 pg/mL [43.5-80.3]) compared to patients without SPH (39.4 pg/mL [28.2-53.2]; P = .016). Changes in cortisol and ACTH levels during the CRH stimulation test were similar between the 2 groups, but patients with SPH who underwent the overnight high-dose dexamethasone suppression test (n = 8) had lower suppression of cortisol after dexamethasone (–58.0% [–85.4 to –49.7]) compared to patients without SPH (n = 120) (–86.0% [–90.5 to –76.7]; P = .035) (Fig. 2). When the cutoff of suppression of more than 69% was considered, patients with SPH had a lower chance of suppressing more than 69% compared to patients without SPH (OR: 0.18; 95% CI, 0.03-0.95). Figure 2. Open in new tabDownload slide Cortisol levels before and after high-dose dexamethasone suppression test in patients with and without subclinical pituitary hemorrhage, necrosis, and/or cystic degeneration (SPH). Remission After Surgical Treatment and Risk for Recurrence The chance of immediate postoperative remission after surgery was similar in patients with and without SPH. For patients with initial remission and follow-up of at least 3 months, analysis of the risk of recurrence did not show a difference in recurrence rate between the 2 groups (HR: 1.12; 95% CI, 0.13-9.4, in the SPH group compared to the non-SPH group, adjusting for the neurosurgeon). Discussion SPH is often an incidental finding in the imaging evaluation of patients with PAs. The frequency of SPH in patients with CD is low (7.1% in our study) but these patients may differ in terms of their history of shorter duration of symptoms and the biochemical evaluation. More specifically, patients with CD and SPH showed higher ACTH levels and lower suppression of cortisol to high-dose dexamethasone. This, however, did not affect their prognosis in terms of immediate postoperative remission and long-term risk of recurrence. SPH has been mainly studied in cohorts of patients with various types of PAs. From these studies important conclusions have been made suggesting that the risk of SPH is higher in patients with large nonfunctioning PAs or prolactinomas. Other risk factors for pituitary apoplexy are thought to be size of the adenoma, change in size, initiation, and withdrawal of dopamine agonists, type of dopamine agonist, use of anticoagulants, diabetes mellitus, hypertension, head trauma, radiotherapy, and preceding dynamic endocrine testing. Patients with CD often represent a small portion of these cohorts, and to our knowledge there is no study to investigate how these patients respond to stimulation/suppression tests. For that reason, we evaluated these findings in our cohort of only patients with ACTH-secreting adenomas. As most of our referrals involve pediatric patients, we limited our cohort only to patients diagnosed at younger than 21 years to have a more homogeneous group. The pathogenesis of pituitary apoplexy has been hypothesized to lie in more friable vessels in PAs, which, while the tumor increases in size, are more susceptible to rupture or cause surrounding feeding vessels to extend and bleed [7, 15]. CS, because of the coexisting hypercortisolemia, leads independently to endothelial dysfunction and coagulation defects, which are often apparent as easy bruising, thrombotic events, and other signs. However, review of the literature and the estimated frequency of SPH in our cohort suggest that patients with CD are not at increased risk for SPH, potentially related to the relatively small adenomas present in these patients [16, 17]. The main difference of patients with CD and SPH compared to those without lies in their biochemical testing, more characteristically in lower suppression to dexamethasone. The overnight high-dose dexamethasone suppression test was originally designed to differentiate various types of CS [18]. Although originally described as a highly accurate test, in clinical practice, cutoffs of 50% to 80% have shown variable sensitivity and specificity and certain centers opt not to use this test unless all other diagnostic evaluations yield confounding results [19-21]. In previous studies a threshold of suppression of more than 69% showed the highest accuracy (sensitivity: 71%, specificity: 100%), and we have incorporated this in our diagnostic algorithm (acknowledging the limitations of the test) [22, 23]. In our analysis, patients with SPH had lower suppression of cortisol under the effect of high-dose dexamethasone and a higher chance of not passing the aforementioned threshold. The mechanism for the lower suppression to dexamethasone of these tumors may be due to lower vascular circulation of dexamethasone at the level of the tumor, and/or the lower sensitivity of necrotic cells to the negative feedback by circulating glucocorticoids. A limitation of this study was that the diagnosis of SPH was based on MRI findings. However, MRI sequences and machines differed between patients and over time. Thus, although large hemorrhagic/necrotic lesions are probably accurately identified, it is possible that smaller lesions are misclassified as negative; the effect of smaller hemorrhagic areas to the biochemical testing may however be smaller as well. Further, the MRIs were not read by a central radiologist, but rather from the radiologist on call at each time point, and this could lead to discrepancies in readings. In addition, our cohort’s data may not be generalized to the pediatric or adult CD population, as often our referrals consist of patients with difficult to treat, small, or otherwise unusual tumors. In conclusion, SPH may be incidentally identified in up to 7% of patients with CD. Patients with CD and SPH may differ in terms of their response to endocrine tests, and this finding should be incorporated in their evaluation. Abbreviations ACTH adrenocorticotropin CD Cushing disease CRH corticotropin-releasing hormone CS Cushing syndrome HR hazard ratio MRI magnetic resonance imaging NICHD Eunice Kennedy Shriver National Institute of Child Health and Human Development OR odds ratio PA pituitary adenoma SPH subclinical pituitary hemorrhage UFC urinary free cortisol Financial Support This work was supported by the intramural research program of the Eunice Kennedy Shriver NICHD, NIH, Bethesda, MD 20892, USA. Disclosures Dr Stratakis holds patents on the function of the PRKAR1A, PDE11A, and GPR101 genes and related issues; his laboratory has also received research funding on the GPR101 gene, and on abnormal growth hormone secretion and its treatment by Pfizer, Inc. He is currently employed by ELPEN, SA and has been consulting for Lundbeck Pharmaceuticals and Sync, SA. The other authors have nothing to disclose. Data Availability Some or all datasets generated during and/or analyzed during the current study are not publicly available but may be available from the corresponding author on reasonable request. Published by Oxford University Press on behalf of the Endocrine Society 2022. This work is written by (a) US Government employee(s) and is in the public domain in the US. Published by Oxford University Press on behalf of the Endocrine Society 2022. Adapted From https://academic.oup.com/jes/article/6/7/bvac080/6586876?login=false
  20. Abstract Background Endoscopic endonasal surgery is the main transsphenoidal approach for pituitary surgery in many centers, however few studies compare the endoscopic and microscopic surgical approach with regard to long-term follow-up. This single-center study aimed to compare the two techniques over 15 years. Methods Medical records and magnetic resonance images from 40 patients with primary transsphenoidal surgery for Cushing’s disease at Sahlgrenska University Hospital between 2003 and 2018 were reviewed. Fourteen patients who underwent microscopic surgery and 26 patients who underwent endoscopic surgery were included in this study. Results In the microscopic group, 12 of 14 patients achieved endocrine remission, compared to 19 of 26 patients in the endoscopic group (n. s.). Three patients in each group developed a late recurrence. Complications were seen in 5 patients in the microscopic group and in 8 patients in the endoscopic group (n. s.). No serious complications, such as carotid artery damage, cerebrovascular fluid leakage, epistaxis, or meningitis, occurred in any group. The postoperative hospital stay was shorter in the endoscopic than the microscopic group. Conclusion Endoscopic endonasal surgery for Cushing’s disease showed no difference in remission, recurrence, and complication rates compared to the microscopic approach. The endoscopic group had a shorter postoperative hospital stay than the microscopic group, which in part may be due to the minimal invasiveness of the endoscopic approach. References (0) Cited by (0) Recommended articles (6) Research article Identifying obstructive sleep apnea in patients with epilepsy: A cross-sectional multicenter study Seizure, Volume 100, 2022, pp. 87-94 Show abstract Research article Nursing Home Characteristics Associated with High and Low Levels of Antipsychotic, Benzodiazepine, and Opioid Prescribing to Residents with Alzheimer’s Disease and Related Dementias: A Cross-Sectional Analysis Journal of the American Medical Directors Association, 2022 Show abstract Research article Association between sensory impairments and restricted social participation in older adults: A cross-sectional study Collegian, 2022 Show abstract Research article Percutaneous Intervertebral-Vacuum Polymethylmethacrylate Injection for Foraminal Stenosis with Degenerative Lumbar Scoliosis World Neurosurgery, 2022 Show abstract Research article Predictors of Emergency Department service outcome for people brought in by police: A retrospective cohort study International Emergency Nursing, Volume 63, 2022, Article 101188 Show abstract Research article Interdisciplinary Care Coordination in Chronic Viral Hepatitis C The Journal for Nurse Practitioners, 2022 Show abstract Conflicts of interest The authors have no conflicts of interest. Author statements Conceptualization: D. Farahmand, E. Backlund, O. Ragnarsson and P. Trimpou Data curation: Dan Farahmand, Erica Backlund, J. Carlqvist, T. Skoglund, T. Hallén, O. Ragnarsson, P. Trimpou. Formal Analysis: D. Farahmand, E. Backlund Funding acquisition: D. Farahmand Investigation: D. Farahmand, E. Backlund, O. Ragnarsson and P. Trimpou Methodology: D. Farahmand, E. Backlund, O. Ragnarsson and P. Trimpou Project administration: D. Farahmand, E. Backlund, O. Ragnarsson and P. Trimpou Supervision: D. Farahmand Writing – original draft: Penelope Trimpou Writing – review & editing: E. Backlund, O. Ragnarsson, T. Skoglund, T. Hallén, G. Gudnadottir, J. Carlqvist and D. Farahmand. View full text From https://www.sciencedirect.com/science/article/abs/pii/S1878875022009640
  21. Background Cushing’s disease (CD) is among the most common etiologies of hypercortisolism. Magnetic resonance imaging (MRI) is often utilized in the diagnosis of CD, however, up to 64% of adrenocorticotropic hormone (ACTH)-producing pituitary microadenomas are undetectable on MRI. We report 15 cases of MRI negative CD who underwent surgical resection utilizing a purely endoscopic endonasal approach. Methods Endoscopic endonasal transsphenoidal surgery (EETS) was performed on 134 CD cases by a single surgeon. Fifteen cases met inclusion criteria: no conclusive MRI studies and no previous surgical treatment. Data collected included signs/symptoms, pre- and post-operative hormone levels, and complications resulting from surgical or medical management. Data regarding tumor diameter, location, and tumor residue/recurrence was obtained from both pre- and post-operative MRI. Immunohistochemistry was performed to assess for tumor hormone secretion. Results Aside from a statistically significant difference (P = 0.001) in histopathological results between patients with negative and positive MRI, there were no statistically significant difference between these two groups in any other demographic or clinical data point. Inferior petrosal sinus sampling (IPSS) with desmopressin (DDAVP®) administration was performed on the 15 patients with inconclusive MRIs to identify the origin of ACTH hypersecretion via a central/peripheral (C/P) ratio. IPSS in seven, five and three patients showed right, left, and central side lateralization, respectively. With a mean follow-up of 5.5 years, among MRI-negative patients, 14 (93%) and 12 patients (80%) achieved early and long-term remission, respectively. In the MRI-positive cohort, over a mean follow-up of 4.8 years, 113 patients (94.9%) and 102 patients (85.7%) achieved initial and long-term remission, respectively. Conclusions Surgical management of MRI-negative/inconclusive Cushing’s disease is challenging scenario requiring a multidisciplinary approach. An experienced neurosurgeon, in collaboration with a dedicated endocrinologist, should identify the most likely location of the adenoma utilizing IPSS findings, followed by careful surgical exploration of the pituitary to identify the adenoma. Peer Review reports Introduction Cushing’s disease (CD) is the most common cause of hypercortisolism [1]. Left untreated, CD can result in multiple complications, most often cardiovascular disease or infection, and has a mortality rate 1.7–4.8-times higher than the general population [2,3,4]. Although MRI is the imaging modality of choice for identifying these tumors, imaging is often inconclusive [5]. Prior studies have shown that adrenocorticotropic hormone (ACTH)-producing pituitary microadenomas are undetectable on MRI in 36–64% of cases [5]. However, the development and widespread utilization of 3-T MRI (3TMRI) has led to much higher tumor detection rates [6, 7]. With a negative predictive value of approximately 19–94% and variable sensitivity and specificity, anywhere from 4 to 54% of MRIs are incorrectly reported, especially in the setting of ACTH-secreting pituitary adenomas [8, 9]. With such variation in radiographic appearance, reliance on imaging for the management of CD patients can cause significant uncertainty for neurosurgeons and endocrinologists alike. The choice approach in the surgical management of these adenomas is via an endoscopic endonasal transsphenoidal surgery (EETS) [2, 10, 11], resulting in overall post-operative remission rates of 64–93% globally and 50–71% for cases without a conclusive MRI [12,13,14,15]. Inconclusive MRIs pose a significant challenge in the surgical management of CD, with the decision to pursue surgery for MRI-negative CD remaining highly controversial [8, 10, 14, 16]. In this study, we report 15 cases of CD without positive MRIs who underwent adenoma resection via EETS. Patients, materials and methods Patients population Between January 2005 and December 2018, EETS was performed in 134 CD cases by a single surgeon at Loghman hakim and Erfan hospitals. Of those patients, 15 cases met inclusion criteria: inconclusive MRI studies and no prior surgical treatment. The population consisted of 12 women (mean age 32.5 years; range 14–65 years) and 3 men (mean age 35 years; range 22–60 years). Data collected included signs/symptoms, pre- and post-operative hormone levels, and complications resulting from surgical or medical management. Data regarding tumor diameter, location, and tumor residue/recurrence was obtained from both pre- and post-operative MRIs. Immunohistochemistry was performed to assess for tumor hormone secretion. Ethics approval and consent to participate All procedures performed in this study involving human participants were in accordance with the ethical standards and approved by the Shahid Beheshti Medical University (SBMU) Ethical Committee and the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Also, a written informed consent was obtained from all subjects (or their parent or legal guardian in the case of children under 16). Imaging All patients underwent pre- and post-operative dynamic pituitary MRI via a superconducting 1.5-T scanner. Prior to gadolinium injection, T1-weighted Spin Echo (SE) and T2-weighted turbo SE images, followed by coronal dynamic acquisition (T1-weighted turbo SE), were obtained in the coronal plane using the following protocol: TR/TE, 400/20 ms; 288 · 192 matrix; two excitations; 18 · 18 cm field of view (FOV); 3 mm in thickness with 0.3-mm intersection gap. Afterwards, with simultaneous gadolinium injection, coronal and sagittal T1-weighted SE images were obtained 2 minutes following injection. All images were independently reviewed by both a radiologist and a neurosurgeon. MRIs studies were categorized into direct and indirect signs of CD. Direct signs consisted of any inhomogeneity found in the pituitary, such as a lesions with diminished enhancement. Indirect signs included pituitary stalk deviation and bulging or erosion of the sellar contour. MRI studies were considered negative (normal) if no direct or indirect signs were identified. In some cases, small lesions with diameters under 6 mm may be seen on MRI however are not considered indicative of CD due to the high prevalence of incidentalomas in this region. MRIs in which these lesions were present were classified as inconclusive. Any uncertainty in interpreting the MRIs by any of the reviewers resulted in exclusion of the image from this study. Pre-operative endocrine examination All cases were ACTH-dependent Cushing syndrome showing clinical features including weight gain, proximal myopathy, and wide base purple striae. Furthermore, all cases demonstrated laboratory abnormalities consistent with CD, including increased 24-hour urinary free cortisol (UFC) excretion, loss of the cortisol circadian rhythm, high basal ACTH level, failure of low-dose dexamethasone to suppress cortisol secretion in addition to serum suppression or 24-hour UFC after high-dose dexamethasone. Additionally, pre- and post-operative levels of anterior pituitary hormone including prolactin, growth hormone (GH), insulin-like growth factor I (IGF-I), thyroid stimulating hormone (TSH), free/total Triiodothyronine (T3)/ Thyroxine (T4), follicle-stimulating hormone (FSH), Luteinizing hormone (LH), and free/total testosterone (men) or estradiol (premenopausal women) were measured. The 15 cases of MRI negative CD were diagnosed and categorized according to their endocrine profile in order to distinguish the ACTH-dependent CD from pseudo-cushing syndrome. Bilateral inferior petrosal sinus sampling (BIPSS) All 15 cases of MRI-negative ACTH-dependent Cushing’s syndrome underwent bilateral inferior petrosal sinus sampling (BIPSS). To confirm that the elevated ACTH secretion originated from the pituitary, BIPSS was simultaneously performed with central/peripheral (C/P) ACTH gradient measurement, utilizing the calculations described by Oldfield et al. [17]. No significant complications occurred in performing the procedures. A petrosal to peripheral ACTH ratio ≥ 2.0 in the basal state, a peak ratio ≥ 3.0 after desmopressin (DDAVP®) administration, or a normalized IPS:P ratio > 0.8 were considered diagnostic of CD. Additionally, tumor lateralization was specified when the interpetrosal gradient ratio of ACTH was ≥1.4 [18]. Endoscopic Endonasal Transsphenoidal surgical approach All patients underwent surgery by a single neurosurgeon and otolaryngologist (ENT) with extensive experience in pituitary tumor excision via EETS. Exposure to the sellar floor was provided by an ENT surgeon while drilling of the sella was performed by the neurosurgeon. Extensive drilling of the sellar floor laterally up to the carotid artery bilaterally provided a wide view of the medial wall of the cavernous sinus as well as exposure of the anterior and posterior intercavernous sinuses was performed in all cases. The dura was then opened to expose the pituitary gland. Following tumor identification, adenomectomy was performed with selective removal of a rim of normal pituitary tissue. In cases where a tumor was not visualized on initial exposure of the pituitary, the pituitary gland was explored laterally via a horizontal paramedian incision on the IPSS suggesting side. If a tumor was not visualized at this stage, a vertical paramedian incision was then performed. In some cases, a cream-like substance was drained from the pituitary incision. Although this was suspicious of a tumor and tissue biopsy was obtained, it was not considered a definite tumor diagnosis and thus surgical exploration (EXP) was done in the same manner on the other side of the pituitary. In the scenario where no distinct adenoma was found, both sides of the pituitary gland underwent EXP with emphasis on lateralizing sides distinguished by IPSS. However, we did not rely solely on IPSS lateralization, as whole gland EXP was performed in all cases. Although ACTH secreting pituitary adenomas are the most common cause of Cushing syndrome, pituitary adenomas can also be ectopic, forming outside of the sella turcica with no direct connection to the pituitary gland [19]. After EXP of each side of the gland, ipsilateral periglandular inspection with visualization of the medial wall of the cavernous sinus and diaphragm was performed to identify a potential ectopic microadenoma in the periglandular region. Although the exact origin of ectopic ACTH-producing pituitary adenomas is unclear, they likely emerge from remnants of Rathke’s pouch during its development course [20]. As a result, these tumors can be discovered in the nasopharynx, sphenoid sinus, cavernous sinus, clivus, or suprasellar area [21]. Detecting an adenoma at this stage may prevent further unnecessary EXP of pituitary gland. If a visible tumor was still not detected, a vertical medial incision was made on the pituitary gland adjacent to the pituitary stalk and neurohypophysis. If a tumor could not be reliably identified by extensive EXP of the entire pituitary gland or BIPSS failed to localize a pituitary adenoma, we did not progress to performing incomplete or complete hypophysectomy. Figures 1 and 2, respectively, demonstrate the surgical management algorithm and pituitary incisions for MRI-negative CD. Fig. 1 Eight-step MRI negative Cushing’s disease surgical management Full size image Fig. 2 Schematic illustration of 8 steps in endoscopic endonasal approach to MRI inconclusive Cushing’s disease (Resembling half Georgia flag) Full size image If an ectopic ACTH-secreting adenoma is not easily found, permanent destructive or ablative surgeries such as bilateral adrenalectomy and hypophysectomy may be required [20]. Despite the danger of Nelson syndrome, bilateral adrenalectomy remains a feasible option in the management of refractory CD [22, 23]. Histological examination All intraoperative tissue specimens obtained underwent histological examination by a pathologist. Pituitary specimens were fixed in buffered 10% formalin and embedded in paraffin wax. All specimens were first examined by Hematoxylin and Eosin (H&E) staining to detect regions which had loss of acinar organization. Additionally, reticulin and periodic Acid-Schiff (PAS) staining was implemented for a more accurate histopathologic diagnosis. Immunohistochemistry staining was used to identify cytokeratin and anterior pituitary hormones, including ACTH, in the case of a pituitary adenoma not being detected by H&E staining. The presence of ACTH-secreting cells was examined via immunocytochemistry using specific anti-ACTH antibodies. Post-operative endocrinologic assessment and follow up Serum cortisol and ACTH levels were monitored for 2–5 days following surgery. Initial follow-up occurred 2 weeks post-operatively with a subsequent visit occurring 3 months postoperatively, during each visit a complete pituitary hormonal evaluation was performed. This evaluation was repeated every 3 months for up to 2 years and every 6 months after that. An initial postoperative pituitary MRI was typically performed within 3 months after surgery. For patients to be considered to be in initial post-operation remission, a basal plasma cortisol level lower than 140 nmol/L (5 μg/dL) or adequate suppression of plasma cortisol (≤56 nmol/L) (≤1.8 μg/dL) following the 1-mg dexamethasone suppression test was necessary during the first month following surgery. Long term remission was defined as a plasma cortisol lower than 84 nmol/L (3 μg/dL) after a 1-mg dexamethasone suppression test at the final visit. Recurrence was defined as a recurring case of hypercortisolism with insufficient suppression of plasma cortisol (> 140 nmol/L) after a 1-mg dexamethasone suppression test. Clinical criteria for remission included significant symptomatic improvement or resolution without additional therapy (radiotherapy, adrenalectomy). Patients achieving remission had to meet both laboratory and clinical criteria to be classified as such. Glucocorticoids were not given postoperatively except when there was laboratory evidence of hypercortisolism and/or clinical manifestations of glucocorticoid insufficiency. Additionally, 4 to 6 weeks post-operatively, thyroid and gonadal axis function was assessed by measuring free T4, TSH, FSH, and LH levels in addition to end-organ hormones (estradiol in women and testosterone in men). Statistical analysis SPSS software (version 26, Chicago, IL) was used to analyze the data. For continuous data, we calculated descriptive statistics, mean and standard deviation (SD), and for categorical variables, frequency and percentages were calculated. The chi-square or Fisher’s exact test was used to analyze categorical data, while the student’s t-test or Mann- Whitney U test was used to analyze continuous variables’ means, depending on the distribution’s normality. Statistical significance was defined by a p value of < 0.05. Results Demographic and clinical data of 134 patients with CD who underwent EETS are shown in Table 1. Fifteen (11.2%) of the 134 CD patients who underwent EETS were MRI-negative and 119 patients (88.8%) were MRI positive. The female/male ratio in the MRI-negative group was four to one while this ratio in the MRI-positive cohort was 2.6. With regards to sex distribution, Fisher’s exact test found no statistically significant difference between these two groups (P = 0.565). All patients had clinical manifestation of Cushing’s syndrome including obesity, hirsutism, glucose intolerance, and hypertension. As shown in Table 1, pre-operative ACTH level was 134.02 ± 21.78 ng/l and 151.76 ± 44.17 ng/l in MRI-negative and MRI-positive patients, respectively, and no statistically significant difference was observed between these two groups (P = 0.781). As demonstrated in Table 1, UFC was 462.3 ± 43.98 μg/24 h and 478.4 ± 73.02 in MRI-negative and MRI-positive patients, respectively, and no statistically significant difference was observed between these two groups (P = 0.832). Table 1 Demographic and clinical data Full size table IPSS with DDAVP® administration was performed on the 15 MRI-negative patients to identify the origin of ACTH hypersecretion via the C/P ratio. Seven patients showed right-sided lateralization and five patients showed left-sided lateralization. In remaining three patients, IPSS did not show an ACTH interpetrosal gradient ratio greater than the cutoff point, which was interpreted as an ACTH hypersecretion with central origin. On EXP, adenomas were found in 2 of the 3 patients, with no adenoma being found in the 3rd. The IPSS results were in concordance with our observations during EXPs in 60% of patients. However, in 13% of patients, no adenoma was detected, and in 26% an adenoma was found on the opposite side of the pituitary where pre-operative IPSS results initially reported a tumor or was suggestive of one being present. In 60% of MRI-negative patients, histological examination demonstrated an adrenocorticotropic pituitary adenoma, but in 40% no adenoma was found after pathological examinations. In MRI-positive patients, positive histology was observed in 112 patients (94.1%), while in 7 patients (5.9%) histopathological studies were negative. Fisher’s exact test revealed that the difference between MRI-negative and MRI-positive patients in terms of histopathological result was statistically significant (P = 0.001). In all four patients who had discordant IPSS results as well as the patients who had negative or inconclusive findings on EXP, tissue samples were obtained from suspicious sites during EXP and were sent for histopathological examination. Histopathology demonstrated adrenocorticotropic adenoma tissues in 3 of them on the opposite side of the IPSS suggested region, while in 1 of them the histological results were inconclusive. This patient (case 10) achieved initial remission, however she experienced recurrence after 25 months, and similarly to her initial presentation, MRI findings were negative and IPSS suggested right sided lateralization. She underwent revision surgery, and a distinct adenoma was detected on the right side, which was confirmed by histological examination, after which she went into remission following selective adenectomy (Table 2). Table 2 Presents summary of patients’ demographics, IPSS and surgical exploration results Full size table Among the patients with inconclusive MRI, 14 (93%) achieved initial remission, 12 of which (80%) went on to long term remission with a mean follow up of 5.5 years. Two patients (cases 10 and 11) developed recurrence following initial remission; according to the IPSS suggested side, partial hypophysectomy was performed in both cases however neither was able to achieve remission afterwards. One patient (case 13) was unable to achieve initial remission following the initial surgery and thus required continued medical management. With a mean follow-up of 4.8 years among the 119 patients with positive MRI, 113 patients (94.9%) and 102 patients (85.7%) achieved initial and long-term remission, respectively. There were no statistically significant differences between these two groups in terms of either initial (P = 0.767) or long-term remission (P = 0.457). Among the 102 patients who achieved long-term remission, 12 patients (11.7%) experienced disease recurrence. With regards to recurrence rate, there was no statistically significant difference between patients with either positive or negative MRI (P = 0.542). In two patients (cases 2 and 6) the adenoma was not found during EXP, however tissue samples obtained from the IPSS suggested side demonstrated adrenocorticotropic pituitary adenoma in both patients on histopathological examination. Diabetes insipidus (DI) was the most frequent complication associated with CD. Transient DI occurred in seven cases with resolution prior to discharge. There was one case of permanent DI diagnosed in follow-up. Additionally, one patient developed symptomatic adrenal insufficiency requiring glucocorticoid replacement. Two patients developed hypothyroidism requiring hormone replacement. Panhypopituitarism was not seen following the initial surgeries however occurred in one case following revision surgery (partial hypophysectomy) which required hormone replacement therapy. Cerebrospinal fluid (CSF) leak resulting in meningitis was seen in one patient, however no other complications occurred during the post-operative period. None of our patients demonstrated clinical or endocrinological signs of gonadal insufficiency in follow-up aside from the aforementioned case of panhypopituitarism following revision partial hypophysectomy. In the MRI-positive cohort, 51 patients showed transients DI (42.8%), with 4 of the patients (3.4%) experiencing DI till last follow-up. Partial anterior pituitary insufficiency and complete anterior pituitary insufficiency was observed in one (0.8%) and two (1.6%) patients, respectively. Syndrome of inappropriate antidiuretic hormone (SIADH) secretion was observed in 3 patients (2.5%). Discussion In this study we present the outcomes of pure endoscopic endonasal surgical treatment of fifteen patients with MRI-negative Cushing’s disease. Due to the arduous nature of treatment in this patient population, we used a precise method of EXP as described above, resulting in initial remission in 93% of patients post-operatively. Based on the work of Bansal et al., patients with a definite adenoma on MRI who underwent microscopic transsphenoidal surgery had a statistically significant greater rate of early remission and lower rates of persistent disease than those with negative/equivocal findings [24]. However, in terms of late remission and recurrence, there was no statistically significant difference between these two groups [24]. Negative/equivocal MRI results and the incidence of macroadenoma, particularly in patients with cavernous sinus invasion, were found to predict poor remission rates [24]. According to some investigations, MRI-negative CD patients had a poorer remission rate [25, 26]. In other studies, however, there was no statistically significant difference in remission between those who had MRI-negative CD and those who had a MRI-positive CD, which is consistent with our result [14, 27,28,29,30,31,32]. Recurrence occurred in 2 patients, while 12 patients showed no clinical or endocrinological signs of recurrence during the mean follow-up of 5 years, and one patient did not go to remission. Aside from one CSF leak leading to meningitis and one case of permanent DI, there were no major surgery related complications. Pituitary CD is a common and potentially lethal condition that, if left untreated, can lead to sequelae such as morbid obesity, hypertension, and diabetes mellitus. Diagnosis and treatment of CD is more challenging than other functional pituitary adenomas. Currently, trans-sphenoidal pituitary EXP is considered the standard of care for CD [33,34,35]. CD is typically diagnosed by endocrinologist through clinical symptoms, and supported by laboratory tests such as the 8 AM blood or saliva cortisol level, 24 hours urinary free cortisol level, low- and high-dose dexamethasone suppression tests, and the corticotropin-releasing hormone (CRH) stimulating test [36,37,38]. When ACTH-dependent CD is diagnosed, or clinical signs and symptoms are highly suggestive of it, MRI imaging of the pituitary is often the next step to identify the causative agent i.e., a pituitary adenoma. With regards to pituitary lesions, MRI is considered the most sensitive imaging modality, however reported sensitivity varies significantly between studies, with reported rates ranging from 22 to 92% [39,40,41]. The rate of MRI-negative microadenomas is reported to be between 36 to 63% [5]. Hofmann et al. reported no identified tumor in 49.3% of 270 MRIs [29]. Yamada et al. reported a lower frequency (17%) of MRI-negative CD in their series [42]. In our series, only 15 out of 134 (11.19%) CD patients were MRI-negative. In general, negative-MRIs could be explained by several factors such as field strength, technique (the correct pulse sequence and parameters), radiologist interpretation errors, or tumor size. Identifying tumors smaller than 3 mm in diameter is difficult in MRIs with 2.5- to 3-mm-thick image sections [29]. Dynamic MRI and 3-TMRI can result in a higher sensitivity in identifying ACTH-secreting microadenomas [6, 7, 43]. In addition, spoiled gradient-recalled echo sequence (SPGR) view can help to increase sensitivity [44]. The relatively low number of negative-MRIs in our study can be attributed to the more extensive review of MRI images, utilization of high-field strength MRI (1.5 T), as well as the implementation of SPGR dynamic studies with 1.5- to 2.0-mm-thick sections, in addition to standard methods. Additionally, assessment of images by experienced pituitary neuroradiologists may have reduced the negative-MRI rate in our series. Although small tumor size is a likely factor in MRI-negative CD, prior studies have reported examples of MRI-negative microadenomas 4-6 mm in size, typically large enough to be easily identified on EXP [42]. If MRI is unable to identify the tumor definitively, the next best step is venous sampling to confirm CD. There are various indication for BIPSS, including patients who have clinical and laboratory findings of CD but normal or inconclusive MRI results [45], cases that do not have a clear hormone test response, or cases where there are inconsistencies between laboratory and imaging results [46]. BIPSS is also recommended by some as standard for any case of confirmed ACTH-dependent Cushing’s syndrome [47, 48]. In our institution, BIPSS is reserved for MRI-negative Cushing’s patients. Newell-Price et al. reviewed 21 studies with 569 total patients, and found that BIPSS with CRH stimulation had a 96% sensitivity and 100% specificity in separating CD from pseudo-Cushing’s states [49]. Most studies report a 90–100% sensitivity and specificity for BIPSS [50,51,52]. In the majority of cases of CD, a pituitary microadenoma can be found eccentric to one side of the pituitary, having venous drainage directly into the ipsilateral inferior petrosal sinus (IPS) [53]. This phenomenon is the basis for utilizing BIPSS as a means of lateralizing ACTH secreting pituitary tumors. There are many instances where EXP fails to detect a pituitary adenoma, despite conformation of pituitary origin of ACTH secretion via BIPSS. Evidence of lateralization prior to surgery can convince the surgeon to perform a guided hemi hypophysectomy. In our series, the accuracy of BIPSS for lateralizing adenomas was 60%, similar to the reported accuracy in the literature of approximately 70% [17]. Inaccurate lateralization from BIPSS has been attributed to asymmetrical venous drainage with shunting of blood toward the dominant side. Thus, BIPSS appears to be a superior diagnostic tool compared to other means of lateralization, and neurosurgeons should be wary of making operative decisions solely from BIPSS data [49]. The standard of care for MRI-negative CD is highly disputed. There is evidence suggesting surgical exploration is more problematic than watchful waiting [8], or that it is not indicated in MRI-negative CD [54]. Many advancements have led to the widespread adoption of transsphenoidal approach during the last three decades, especially the endoscope [31]. Regardless of the width or depth of access, the endoscopic approach allows the surgeon to have a large panoramic view. Many cases in the literature have reported successfully treating functional pituitary tumors via endoscopic surgery [27, 31, 55,56,57,58]. The results suggest that they are on par with, if not superior to, traditional microscopic approaches. When patients were operated on utilizing a microscopic technique assisted by a pre-operative ACTH gradient, the overall rate of partial adenomectomy (partial hypophysectomy) was 30%, including 19% in patients with positive MRIs and 40% in those with negative MRIs [28]. However, endoscopic visualization of pituitary adenomas has allowed for the need for partial adenomectomy to be reduced to less than 2%, limiting the damage to the normal pituitary gland during operation [28]. A recently published meta-analysis demonstrated that although there was no statistically significant differences between EETS and microscopic endonasal transsphenoidal surgery in the sub-analysis with regards to recurrence rate, remission rate, and persistence rate, the recurrence rate in the microscopic endonasal transsphenoidal surgery group was almost three times higher than in the EETS group [11]. As a result, EETS appears to be a possible suggested therapeutic method, while more studies are needed to establish the therapeutic method of choice [59]. In general, pituitary surgery is not advisable in cases of MRI-negative CD where IPSS is not able to prove a central origin of ACTH secretion [42]. However, when IPSS demonstrates central ACTH secretion, surgical intervention has been proposed as a first line treatment in MRI-negative CD [25, 32, 42, 60]. The outcome of surgical intervention in MRI-negative patients is variable in the literature. Some reports indicated lower remission rate in these patients [42, 61], while others have concluded that EXP results in greater complications in this population [8, 15]. Additionally, several studies have shown no significant difference in outcomes of pituitary surgery between MRI-negative and MRI-positive patients [14, 25, 32]. Pivonello et al. found the lack of tumor detection on pre-operative MRI operation to be a negative prognostic factor in surgical management [62]. In the present study, surgery was performed for all MRI-negative Cushing’s patients with positive IPSS results. We achieved 93% initial remission and 80% long term remission rates, comparable to mean remission rates in patients with preoperative identification of tumor, as reported in the literature, ranging from 52.6–100% [62]. Failure to identify an adenoma on EXP or in histologic examination is not uncommon in the surgical management of CD. Intraoperative detection of the adenoma has been shown to be a factor of favorable prognosis [63,64,65]. Similarly, failure to identify an adenoma on histopathology has been found to be a negative prognostic indicator. Specifically, remission rates were significantly lower in cases where no histological tumor identification could be provided [14, 63, 66]. In our study, two cases revealed no adenoma on EXP, however the tissue samples subsequently obtained from the IPSS suggesting side were consistent with pituitary adenoma on histologic examinations. In six cases, a cream-like substance was identified within the pituitary following incision, however histologic examination failed to demonstrate adrenocorticotropic adenoma in any of them. Nonetheless, 5 of the 6 patients went into remission following surgery, potentially due to the small size of tissue samples obtained which in turn made accurate histopathological assessment more difficult [14, 67]. In cases where EXP does not result in localization of an adenoma, surgical decision making becomes complicated. Generally, total hypophysectomy is not advisable due to high rates of endocrine complications as well as failing to provide significantly increased remission rates over partial hypophysectomy [62, 68]. In this scenario, multiple studies have recommended partial hypophysectomy based on IPSS lateralization as the next best step in management [63, 69]. Carr et al. suggested the advantage of 2/3 gland resection on remission rate in MRI-negative CD [60], but as previously discussed, IPSS may incorrectly lateralize adenomas, and thus surgeons should be hesitant when making decisions regarding tumor lateralization based solely on BIPSS data [17, 49]. Moreover, both adenomectomy and hypophysectomy are not without risks and potential complications. Surgical aggressiveness is correlated with increased likelihood of pituitary loss-of-function, supported by literature showing that the larger the amount of resection, the higher the rate of hypopituitarism. It has been reported that patients undergoing adenomectomy, hemi-hypophysectomy, and-total hypophysectomy had mean rates of hypopituitarism of 6.6, 20.2, and 80.2%, respectively [63, 70, 71]. As most CD patients are females of reproductive age, preserving child-bearing capacity is an important consideration, one which results in reluctance to perform hemi-hypophysectomy. In our series, we performed selective adenectomy when distinct adenomas were found, and in the cases where no adenoma was detected, meticulous EXP of pituitary gland bilaterally was performed. Subsequently, if EXP was inconclusive, a vertical median incision was made near the pituitary stalk to explore central part of the gland, which is believed to be the nest for adrenocorticotropic cells. Although an important step in localizing the adenoma, this also likely explains the high rate of postoperative DI in our study. No additional hemi-hypophysectomy was performed during the initial surgery in our study. With this technique, we achieved acceptable results with regards to remission rates, and none of our patients experienced panhypopituitarism in postoperative follow-ups. In one patient where CD recurred 2 years post-operatively, inadequate bony exposure and limited visualization of the medial wall of the right cavernous sinus resulted in failure to identify the adenoma during the initial surgery, further supporting the strategy of creating extensive exposure of the operative field in MRI-negative CD. Another possible reason for recurrence in this patient would be growth of a previously undetected microadenoma. Conclusion Surgical treatment of MRI-negative Cushing’s disease is a demanding scenario necessitating multidisciplinary management. An experienced neurosurgeon working in collaboration with an endocrinologist should specify the most likely region of the tumor via IPSS. Additionally, surgical exploration of the pituitary is an invaluable tool in identifying adenomas while reducing the need for aggressive hypophysectomy, thus decreasing the likelihood of complications. Although MRI-negative Cushing’s disease presents significant challenges to neurosurgeons, surgical management remains essential in achieving remission. Availability of data and materials The authors confirm that the data supporting the findings of this study are available within the article. References Mehta GU, Lonser RR, Oldfield EH. The history of pituitary surgery for Cushing disease: historical vignette. J Neurosurg. 2012;116(2):261–8. PubMed Article Google Scholar Hammer GD, Tyrrell JB, Lamborn KR, Applebury CB, Hannegan ET, Bell S, et al. Transsphenoidal microsurgery for Cushing’s disease: initial outcome and long-term results. J Clin Endocrinol Metabol. 2004;89(12):6348–57. CAS Article Google Scholar Nieman LK. Cushing's syndrome: update on signs, symptoms and biochemical screening. Eur J Endocrinol. 2015;173(4):M33–8. CAS PubMed PubMed Central Article Google Scholar Swearingen B, Biller BM, Barker FG, Katznelson L, Grinspoon S, Klibanski A, et al. Long-term mortality after transsphenoidal surgery for Cushing disease. Ann Intern Med. 1999;130(10):821–4. CAS PubMed Article Google Scholar Lüdecke DK, Flitsch J, Knappe UJ, Saeger W. Cushing's disease: a surgical view; this publication is dedicated to our professor emeritus Dr. med. Rudolf Kautzky. J Neuro-Oncol. 2001;54(2):151–66. Article Google Scholar Bartynski WS, Lin L. Dynamic and conventional spin-echo MR of pituitary microlesions. Am J Neuroradiol. 1997;18(5):965–72. CAS PubMed PubMed Central Google Scholar Erickson D, Erickson B, Watson R, Patton A, Atkinson J, Meyer F, et al. 3 tesla magnetic resonance imaging with and without corticotropin releasing hormone stimulation for the detection of microadenomas in Cushing’s syndrome. Clin Endocrinol. 2010;72(6):793–9. CAS Article Google Scholar Semple PL, Vance ML, Findling J, Laws ER Jr. Transsphenoidal surgery for Cushing's disease: outcome in patients with a normal magnetic resonance imaging scan. Neurosurgery. 2000;46(3):553–9. CAS PubMed Article Google Scholar Tabarin A, Laurent F, Catargi B, Olivier-Puel F, Lescene R, Berge J, et al. Comparative evaluation of conventional and dynamic magnetic resonance imaging of the pituitary gland for the diagnosis of Cushing's disease. Clin Endocrinol. 1998;49(3):293–300. CAS Article Google Scholar Nieman LK, Biller BM, Findling JW, Murad MH, Newell-Price J, Savage MO, et al. Treatment of Cushing's syndrome: an endocrine society clinical practice guideline. J Clin Endocrinol Metab. 2015;100(8):2807–31. CAS PubMed PubMed Central Article Google Scholar Sabahi M, Shahbazi T, Maroufi SF, Vidal K, Recinos PF, Kshettry VR, et al. MRI-negative Cushing's disease: a review on therapeutic management. World Neurosurg. 2022. Ciric I, Zhao J-C, Du H, Findling JW, Molitch ME, Weiss RE, et al. Transsphenoidal surgery for Cushing disease: experience with 136 patients. Neurosurgery. 2012;70(1):70–81. PubMed Article Google Scholar Netea-Maier R, Van Lindert E, Den Heijer M, Van der Eerden A, Pieters G, Sweep C, et al. Transsphenoidal pituitary surgery via the endoscopic technique: results in 35 consecutive patients with Cushing’s disease. Eur J Endocrinol. 2006;154(5):675–84. CAS PubMed Article Google Scholar Salenave S, Gatta B, Pecheur S, Fo S-G, Visot A, Lasjaunias P, et al. Pituitary magnetic resonance imaging findings do not influence surgical outcome in adrenocorticotropin-secreting microadenomas. J Clin Endocrinol Metab. 2004;89(7):3371–6. CAS PubMed Article Google Scholar Semple PL, Laws ER. Complications in a contemporary series of patients who underwent transsphenoidal surgery for Cushing's disease. J Neurosurg. 1999;91(2):175–9. CAS PubMed Article Google Scholar Lonser RR, Nieman L, Oldfield EH. Cushing's disease: pathobiology, diagnosis, and management. J Neurosurg. 2017;126(2):404–17. PubMed Article Google Scholar EH OLDFIELD, ME GIRTON, JL DOPPMAN. Absence of intercavernous venous mixing: evidence supporting lateralization of pituitary microadenomas by venous sampling. J Clin Endocrinol Metab. 1985;61(4):644–7. Article Google Scholar Mamelak AN, Dowd CF, Tyrrell JB, McDonald JF, Wilson CB. Venous angiography is needed to interpret inferior petrosal sinus and cavernous sinus sampling data for lateralizing adrenocorticotropin-secreting adenomas. J Clin Endocrinol Metab. 1996;81(2):475–81. CAS PubMed Google Scholar Thompson LD, Seethala RR, Müller S. Ectopic sphenoid sinus pituitary adenoma (ESSPA) with normal anterior pituitary gland: a clinicopathologic and immunophenotypic study of 32 cases with a comprehensive review of the English literature. Head and neck pathology. 2012;6(1):75–100. PubMed PubMed Central Article Google Scholar Seltzer J, Lucas J, Commins D, Lerner O, Lerner A, Carmichael JD, et al. Ectopic ACTH-secreting pituitary adenoma of the sphenoid sinus: case report of endoscopic endonasal resection and systematic review of the literature. Neurosurg Focus. 2015;38(2):E10. PubMed Article Google Scholar Langford L, Batsakis JG. Pituitary gland involvement of the sinonasal tract. Ann Otology, Rhinology & Laryngology. 1995;104(2):167–9. CAS Article Google Scholar Gurazada K, Ihuoma A, Galloway M, Dorward N, Wilhelm T, Khoo B, et al. Nasally located ectopic ACTH-secreting pituitary adenoma (EAPA) causing Nelson’s syndrome: diagnostic challenges. Pituitary. 2014;17(5):423–9. CAS PubMed Article Google Scholar Pluta RM, Nieman L, Doppman JL, Watson JC, Tresser N, Katz DA, et al. Extrapituitary parasellar microadenoma in Cushing’s disease. J Clin Endocrinol Metabol. 1999;84(8):2912–23. CAS Google Scholar Bansal P, Lila A, Goroshi M, Jadhav S, Lomte N, Thakkar K, et al. Duration of post-operative hypocortisolism predicts sustained remission after pituitary surgery for Cushing’s disease. Endocrine connections. 2017;6(8):625–36. CAS PubMed PubMed Central Article Google Scholar Jagannathan J, Sheehan JP, Jane JA. Evaluation and management of Cushing syndrome in cases of negative sellar magnetic resonance imaging. Neurosurg Focus. 2007;23(3):1–7. Article Google Scholar Pouratian N, Prevedello DM, Jagannathan J, Lopes MB, Vance ML, Laws ER Jr. Outcomes and management of patients with Cushing’s disease without pathological confirmation of tumor resection after transsphenoidal surgery. J Clin Endocrinol Metab. 2007;92(9):3383–8. CAS PubMed Article Google Scholar Cebula H, Baussart B, Villa C, Assié G, Boulin A, Foubert L, et al. Efficacy of endoscopic endonasal transsphenoidal surgery for Cushing’s disease in 230 patients with positive and negative MRI. Acta Neurochir. 2017;159(7):1227–36. PubMed Article Google Scholar Cristante J, Lefournier V, Sturm N, Passagia JG, Gauchez AS, Tahon F, et al. Why we should still treat by neurosurgery patients with Cushing disease and a normal or inconclusive pituitary MRI. J Clin Endocrinol Metab. 2019;104(9):4101–13. Article Google Scholar Hofmann BM, Hlavac M, Martinez R, Buchfelder M, Müller OA, Fahlbusch R. Long-term results after microsurgery for Cushing disease: experience with 426 primary operations over 35 years. J Neurosurg. 2008;108(1):9–18. PubMed Article Google Scholar Testa R, Albiger N, Occhi G, Sanguin F, Scanarini M, Berlucchi S, et al. The usefulness of combined biochemical tests in the diagnosis of Cushing’s disease with negative pituitary magnetic resonance imaging. Eur J Endocrinol. 2007;156(2):241–8. CAS PubMed Article Google Scholar Starke RM, Reames DL, Chen C-J, Laws ER, Jane JA Jr. Endoscopic transsphenoidal surgery for Cushing disease: techniques, outcomes, and predictors of remission. Neurosurgery. 2013;72(2):240–7. PubMed Article Google Scholar Sun Y, Sun Q, Fan C, Shen J, Zhao W, Guo Y, et al. Diagnosis and therapy for Cushing’s disease with negative dynamic MRI finding: a single-Centre experience. Clin Endocrinol. 2012;76(6):868–76. Article Google Scholar Esposito F, Dusick JR, Cohan P, Moftakhar P, McArthur D, Wang C, et al. Early morning cortisol levels as a predictor of remission after transsphenoidal surgery for Cushing’s disease. J Clin Endocrinol Metab. 2006;91(1):7–13. CAS PubMed Article Google Scholar Ram Z, Nieman LK, Cutler GB, Chrousos GP, Doppman JL, Oldfield EH. Early repeat surgery for persistent Cushing's disease. J Neurosurg. 1994;80(1):37–45. CAS PubMed Article Google Scholar Rollin GAFS, Ferreira NP, Junges M, Gross JL, Czepielewski MA. Dynamics of serum cortisol levels after transsphenoidal surgery in a cohort of patients with Cushing’s disease. J Clin Endocrinol Metab. 2004;89(3):1131–9. CAS PubMed Article Google Scholar Minami I, Tateno T, Yoshimoto T, Doi M, Izumiyama H, Akashi T, et al. Subclinical Cushings disease with amelioration of metabolic comorbidities after removal of pituitary tumor. Intern Med. 2006;45(21):1231–5. PubMed Article Google Scholar Nakane T, Kuwayama A, Watanabe M, Takahashi T, Kato T, Ichihara K, et al. Long term results of transsphenoidal adenomectomy in patients with Cushing's disease. Neurosurgery. 1987;21(2):218–22. CAS PubMed Article Google Scholar Buchfelder M, Nistor R, Fahlbusch R, Huk WJ. The accuracy of CT and MR evaluation of the Sella turcica for detection of adrenocorticotropic hormone-secreting adenomas in Cushing disease. Am J Neuroradiol. 1993;14(5):1183–90. CAS PubMed PubMed Central Google Scholar Nieman LK. Medical therapy of Cushing's disease. Pituitary. 2002;5(2):77–82. CAS PubMed Article Google Scholar Escourolle H, Abecassis J, Bertagna X, Guilhaume B, Pariente D, Derome P, et al. Comparison of computerized tomography and magnetic resonance imaging for the examination of the pituitary gland in patients with Cushing's disease. Clin Endocrinol. 1993;39(3):307–13. CAS Article Google Scholar Findling JW, Doppman JL. Biochemical and radiologic diagnosis of Cushing’s syndrome. Endocrinol Metab Clin N Am. 1994;23(3):511–37. CAS Article Google Scholar Yamada S, Fukuhara N, Nishioka H, Takeshita A, Inoshita N, Ito J, et al. Surgical management and outcomes in patients with Cushing disease with negative pituitary magnetic resonance imaging. World Neurosurg. 2012;77(3–4):525–32. PubMed Article Google Scholar Portocarrero-Ortiz L, Bonifacio-Delgadillo D, Sotomayor-González A, Garcia-Marquez A, Lopez-Serna R. A modified protocol using half-dose gadolinium in dynamic 3-tesla magnetic resonance imaging for detection of ACTH-secreting pituitary tumors. Pituitary. 2010;13(3):230–5. CAS PubMed Article Google Scholar Patronas N, Bulakbasi N, Stratakis CA, Lafferty A, Oldfield EH, Doppman J, et al. Spoiled gradient recalled acquisition in the steady state technique is superior to conventional postcontrast spin echo technique for magnetic resonance imaging detection of adrenocorticotropin-secreting pituitary tumors. J Clin Endocrinol Metabol. 2003;88(4):1565–9. CAS Article Google Scholar Findling JW, Raff H. Cushing’s syndrome: important issues in diagnosis and management. J Clin Endocrinol Metab. 2006;91(10):3746–53. CAS PubMed Article Google Scholar Arnaldi G, Angeli A, Atkinson A, Bertagna X, Cavagnini F, Chrousos G, et al. Diagnosis and complications of Cushing’s syndrome: a consensus statement. J Clin Endocrinol Metab. 2003;88(12):5593–602. CAS PubMed Article Google Scholar McCANCE DR, McILRATH E, McNEILL A, DS GORDON, DR HADDEN, KENNEDY L, et al. Bilateral inferior petrosal sinus sampling as a routine procedure in ACTH-dependent Cushing's syndrome. Clin Endocrinol. 1989;30(2):157–66. CAS Article Google Scholar JW FINDLING, ME KEHOE, JL SHAKER, RAFF H. Routine inferior petrosal sinus sampling in the differential diagnosis of adrenocorticotropin (ACTH)-dependent Cushing’s syndrome: early recognition of the occult ectopic ACTH syndrome. J Clin Endocrinol Metabol. 1991;73(2):408–13. Article Google Scholar Newell-Price J, Trainer P, Besser M, Grossman A. The diagnosis and differential diagnosis of Cushing’s syndrome and pseudo-Cushing’s states. Endocr Rev. 1998;19(5):647–72. CAS PubMed Google Scholar Machado MC, De Sa SV, Domenice S, Fragoso MCBV, Puglia P Jr, Pereira MAA, et al. The role of desmopressin in bilateral and simultaneous inferior petrosal sinus sampling for differential diagnosis of ACTH-dependent Cushing's syndrome. Clin Endocrinol. 2007;66(1):136–42. CAS Google Scholar Hernandez I, Espinosa-de-los-Monteros AL, Mendoza V, Cheng S, Molina M, Sosa E, et al. Ectopic ACTH-secreting syndrome: a single center experience report with a high prevalence of occult tumor. Arch Med Res. 2006;37(8):976–80. CAS PubMed Article Google Scholar Invitti C, Giraldi FP, Cavagnini F. Endocrinology SGotHPAAotISo: inferior petrosal sinus sampling in patients with Cushing's syndrome and contradictory responses to dynamic testing. Clin Endocrinol. 1999;51(2):255–7. CAS Article Google Scholar Obuobie K, Davies J, Ogunko A, Scanlon M. Venous thrombo-embolism following inferior petrosal sinus sampling in Cushing’s disease. J Endocrinol Investig. 2000;s23(8):542–4. Article Google Scholar Barrou Z, Abecassis J, Guilhaume B, Thomopoulos P, Bertagna X, Derome P, et al. Magnetic resonance imaging in Cushing disease. Prediction Surg Results. Presse medicale. 1997;26(1):7. CAS Google Scholar Guaraldi F, Zoli M, Asioli S, Corona G, Gori D, Friso F, et al. Results and predictors of outcome of endoscopic endonasal surgery in Cushing’s disease: 20-year experience of an Italian referral pituitary center. J Endocrinol Investig. 2020;43(10):1463–71. CAS Article Google Scholar Shin S, Gardner P, Ng J, Faraji A, Agarwal N, Chivukula S. Endoscopic endonasal approach for ACTH-secreting pituitary adenomas: outcomes and analysis of remission rates and tumor biochemical activity with respect to tumor invasiveness. World Neurosurg. 2015. Wagenmakers M, Boogaarts H, Roerink S, Timmers H, Stikkelbroeck N, Smit J, et al. Endoscopic transsphenoidal pituitary surgery: a good and safe primary treatment option for Cushing’s disease, even in case of macroadenomas or invasive adenomas. Eur J Endocrinol. 2013;169(3):329–37. CAS PubMed Article Google Scholar Zhang K, Shen M, Qiao N, Chen Z, He W, Ma Z, et al. Surgical outcomes and multidisciplinary management strategy of Cushing’s disease: a single-center experience in China. Neurosurg Focus. 2020;48(6):E7. PubMed Article Google Scholar Sabahi M, Shahbazi T, Maroufi SF, Vidal K, Recinos P, Kshettry V, et al. MRI-negative Cushing's disease: a systematic review and Meta-analysis. J Neurological Surg Part B: Skull Base. 2022;83(S 01):A169. Google Scholar Carr SB, Kleinschmidt-DeMasters BK, Kerr JM, Kiseljak-Vassiliades K, Wierman ME, Lillehei KO. Negative surgical exploration in patients with Cushing’s disease: benefit of two-thirds gland resection on remission rate and a review of the literature. J Neurosurg. 2017;129(5):1260–7. Article Google Scholar Bochicchio D, Losa M, Buchfelder M. Factors influencing the immediate and late outcome of Cushing's disease treated by transsphenoidal surgery: a retrospective study by the European Cushing's disease survey group. J Clin Endocrinology Metab. 1995;80(11):3114–20. CAS Google Scholar Pivonello R, De Leo M, Cozzolino A, Colao A. The treatment of Cushing's disease. Endocr Rev. 2015;36(4):385–486. CAS PubMed PubMed Central Article Google Scholar Prevedello DM, Pouratian N, Sherman J, Jane JA, Vance ML, Lopes MB, et al. Management of Cushing's disease: outcome in patients with microadenoma detected on pituitary magnetic resonance imaging. J Neurosurg. 2008;109(4):751–9. PubMed Article Google Scholar Jagannathan J, Smith R, DeVroom HL, Vortmeyer AO, Stratakis CA, Nieman LK, et al. Outcome of using the histological pseudocapsule as a surgical capsule in Cushing disease. J Neurosurg. 2009;111(3):531–9. PubMed PubMed Central Article Google Scholar Burke C, Adams C, Esiri M, Morris C, Bevan J. Transsphenoidal surgery for Cushing's disease: does what is removed determine the endocrine outcome? Clin Endocrinol. 1990;33(4):525–37. CAS Article Google Scholar Acebes J, Martino J, Masuet C, Montanya E, Soler J. Early post-operative ACTH and cortisol as predictors of remission in Cushing’s disease. Acta Neurochir. 2007;149(5):471–9. CAS PubMed Article Google Scholar Mampalam TJ, Tyrrell JB, Wilson CB. Transsphenoidal microsurgery for Cushing disease: a report of 216 cases. Ann Intern Med. 1988;109(6):487–93. CAS PubMed Article Google Scholar Tyrrell JB, Brooks RM, Fitzgerald PA, Cofoid PB, Forsham PH, Wilson CB. Cushing's disease: selective trans-sphenoidal resection of pituitary microadenomas. N Engl J Med. 1978;298(14):753–8. CAS PubMed Article Google Scholar Fomekong E, Maiter D, Grandin C, Raftopoulos C. Outcome of transsphenoidal surgery for Cushing's disease: a high remission rate in ACTH-secreting macroadenomas. Clin Neurol Neurosurg. 2009;111(5):442–9. PubMed Article Google Scholar Rees D, Hanna F, Davies J, Mills R, Vafidis J, Scanlon M. Long-term follow-up results of transsphenoidal surgery for Cushing’s disease in a single Centre using strict criteria for remission. Clin Endocrinol. 2002;56(4):541–51. CAS Article Google Scholar Trainer P, Lawrie H, Verhelst J, Howlett T, Lowe D, Grossman A, et al. Transsphenoidal resection in Cushing's disease: undetectable serum cortisol as the definition of successfuI treatment. Clin Endocrinol. 1993;38(1):73–8. CAS Article Google Scholar Download references Acknowledgments We are grateful to all those who have helped us to accomplish and fulfil this project. Funding None. Author information Authors and Affiliations Department of Neurosurgery, Loghman Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran Guive Sharifi, Amir Arsalan Amin & Seyed Ali Mousavinejad Skull Base Research Center, Loghman Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran Guive Sharifi, Amir Arsalan Amin, Nader Akbari Dilmaghani & Seyed Ali Mousavinejad Neurosurgery Research Group (NRG), Student Research Committee, Hamadan University of Medical Sciences, Hamadan, Iran Mohammadmahdi Sabahi Department of Neurosurgery, Rutgers-New Jersey Medical School, Newark, NJ, USA Nikolas B. Echeverry Department of Otolaryngology, Head and Neck Surgery, Loghman Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran Nader Akbari Dilmaghani Obesity Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran Majid Valizadeh Department of Endocrinology, Loghman Hakim Hospital, Shahid Beheshti Medical University, Tehran, Iran Zahra Davoudi Department of Neurological Surgery, Pauline Braathen Neurological Center, Cleveland Clinic Florida, Weston, Florida, USA Badih Adada & Hamid Borghei-Razavi Cleveland Clinic Lerner College of Medicine of Case Western Reserve University, Director of Minimally Invasive Cranial and Pituitary Surgery Program, Research Director of Neuroscience Institute, Cleveland Clinic Florida Region, 2950 Cleveland Clinic Blvd. Weston, Cleveland, FL, 33331, USA Hamid Borghei-Razavi Contributions Guive Sharifi, Mohammadmahdi Sabahi and Amirarsalan Amin have given substantial contributions to the conception and the design of the manuscript, Mohammadmahdi Sabahi, Nikolas B. Echeverry, Nader Akbari Dilmaghani, Ali Mousavi Nejad, and Zahra Davoudi to the acquisition, analysis, and interpretation of the data. All authors have participated in drafting the manuscript. Mohammadmahdi Sabahi, Majid Valizadeh, and Badih Adada revised it critically. Hamid Borghei-Razavi supervised this project. All authors read and approved the final version of the manuscript. All authors contributed equally to the manuscript and read and approved the final version of the manuscript. Corresponding author Correspondence to Hamid Borghei-Razavi. Ethics declarations Ethics approval and consent to participate All procedures performed in this study involving human participants were in accordance with the ethical standards and approved by the Shahid Beheshti Medical University (SBMU) Ethical Committee and the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Also, informed consent to participate in this study was obtained from participants included in the (or their parent or legal guardian in the case of children under 16). Consent for publication Not applicable. Competing interests All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers’ bureaus; membership, employment, consultancies, stock ownership, or other equity interest; and expert testimony or patent-licensing arrangements), or non-financial interest (such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript. Additional information Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Rights and permissions Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Reprints and Permissions Cite this article Sharifi, G., Amin, A.A., Sabahi, M. et al. MRI-negative Cushing’s Disease: Management Strategy and Outcomes in 15 Cases Utilizing a Pure Endoscopic Endonasal Approach. BMC Endocr Disord 22, 154 (2022). https://doi.org/10.1186/s12902-022-01069-5 Download citation Received27 January 2022 Accepted26 May 2022 Published09 June 2022 DOIhttps://doi.org/10.1186/s12902-022-01069-5 From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-022-01069-5#Sec13
  22. Abstract Background Cushing’s disease (CD) is rare in pediatric patients. It is characterized by elevated plasma adrenocorticotropic hormone (ACTH) from pituitary adenomas, with damage to multiple systems and development. In recent years, genetic studies have shed light on the etiology and several mutations have been identified in patients with CD. Case presentation A girl presented at the age of 10 years and 9 months with facial plethora, hirsutism and acne. Her vision and eye movements were impaired. A quick weight gain and slow growth were also observed. Physical examination revealed central obesity, moon face, buffalo hump, supra-clavicular fat pads and bruising. Her plasma ACTH level ranged between 118 and 151 pg/ml, and sella enhanced MRI showed a giant pituitary tumor of 51.8 × 29.3 × 14.0 mm. Transsphenoidal pituitary debulk adenomectomy was performed and immunohistochemical staining confirmed an ACTH-secreting adenoma. Genetic analysis identified a novel germline GPR101 (p.G169R) and a somatic USP8 (p. S719del) mutation. They were hypothesized to impact tumor growth and function, respectively. Conclusions We reported a rare case of pediatric giant pituitary ACTH adenoma and pointed out that unusual concurrent mutations might contribute to its early onset and large volume. Peer Review reports Background Cushing’s disease (CD) is caused by the overproduction of adrenocorticotropic hormone (ATCH) by pituitary adenomas (PAs). It is rare in children and accounts for approximately 75% of pediatric Cushing’s syndrome from 7 to 17 years of age [1]. Weight gain and facial changes are more common in children than in adults [2]. Growth retardation is also a characteristic of children with hypercortisolemia [3]. Genetic alterations such as somatic USP8, RASD1, TP53 mutations, and germline AIP, MEN1, and CABLES1 mutations have been identified in CD patients [4]. Here we report a case of pediatric invasive pituitary ACTH macroadenoma associated with a novel germline GPR101 (p. G169R) and a somatic USP8 (p. S719del) mutation. Case presentation The girl was born at full term with a length of 48 cm and a weight of 2900 g. Her neuromotor and cognitive development was comparable to those of children of the same age. At the age of 9 years and 4 months she developed plethora, hirsutism, facial acne, rapid weight gain, and increased abdominal circumference. Her skin darkened, and purple striae appeared on thighs and in the armpits. She became dull and less talkative, as indicated by her parents. At 10 years and 3 months, the patient complained of pain around the left orbit with an intensity of 4–5 points on a numerical rating scale (NRS). Five months later bilateral blepharoptosis appeared, with significantly impaired vision of the left eye. Soon both eyes failed to rotate in all directions. On admission the patient was 10 years and 9 months, with a height of 144 cm (90–97th percentile) and a weight of 48 kg (25–50th percentile). Her weight gain was 20 kg, while the height increased by only 2–3 cm in 18 months. Her blood pressure was 115/76mmHg, and her heart rate was 80 bpm. Apart from the signs mentioned above, physical examination revealed central obesity (BMI 23.1 kg/m2), moon face, buffalo hump, supra-clavicular fat pads and bruising at the left fossa cubitalis. Her pupils were 7 mm in diameter and barely reacted to light. There was a fan-shaped visual field defect in the left eye. Her breasts were Tanner stage III and pubic hair was Tanner stage II, although menarche had not yet occurred. The parents and her younger brother at 6 years of age did not have symptoms related to Cushing syndrome, acromegaly or gigantism. There was no family history of pituitary tumor or other endocrine tumors. She had increased midnight serum cortisol (24.35 µg/dL, normal range < 1.8 µg/mL) and 24-hour urine free cortisol (24hUFC) (308.0 µg, normal range 12.3–103.5). The plasma ACTH level ranged from 118 to 151 pg/mL (< 46pg/mL). The 24hUFC was not suppressed (79.2 µg) after 48 h low-dose dexamethasone suppression test (LDDST), but suppressed to 32.8 µg (suppression rate 89.4%) after 48 h high-dose dexamethasone. Sella enhanced MRI showed a giant pituitary tumor measured 51.8 × 29.3 × 14.0 mm with heterogeneous density (Fig. 1). The mass compressed the optic chiasma and surrounded the bilateral cavernous sinus (Knosp 4). Therefore, an invasive giant pituitary ACTH adenoma was clinically diagnosed. The morning growth hormone (GH) was 1.0ng/ml (< 2 ng/ml) and insulin-like growth factor 1 416 ng/ml (88–452 ng/ml). The prolactin (PRL), luteinizing hormone (LH), follicle-stimulating hormone (FSH) and thyroid stimulating hormone (TSH) were all in normal ranges, as well as serum sodium, potassium, blood glucose and urine osmolality. Abdominal ultrasonography revealed a fatty liver. Tests concerning type 1 multiple endocrine neoplasia included serum calcium, phosphate, parathyroid hormone, gastrin and glucagon, which were all unremarkable (Table 1). Fig. 1 Contrast-enhanced coronal (A) and sagittal (B) T1-weighted MRI on admission. The sellar mass measured 51.8 × 29.3 × 14.0 cm (TD × VD × APD) with a heterogeneous density in the enhanced scan. The diaphragma sellea was dramatically elevated, with optic chiasm compressed. The sellar floor was sunken and bilateral cavernous sinus was surrounded (Knosp 4) Full size image Table 1 Laboratory data on admission Full size table Transsphenoidal pituitary debulk adenomectomy was performed immediately due to multiple cranial nerve involvement and the negative results of Sandostatin loading test. A decompression resection was done. The plasma ACTH level declined to 77 pg/ml and serum cortisol 30.2 µg/dl three days after the operation. Vision, pupil dilation, eye movements and blepharoptosis also partially improved. Histopathology and immunohistochemical staining confirmed a densely–granulated corticotroph adenoma (Fig. 2, NanoZoomer S360 digital slide scanner and NDP.view 2.9.25 software, Hamamatsu, Japan). Neither necrosis nor mitotic activity was observed. The immunostaining for somatostatin receptor SSTR2A was positive with a cytoplasmic pattern, while GH, PRL, TSH, FSH, LH and PIT were all negative. The Ki 67 index was found to be 10%. One month after the operation the ACTH level increased to 132 pg/mL again, and the parents agreed to refer their child for radiotherapy to control the residual tumor. Fig. 2 Histopathology and immunohistochemistry staining results of the pituitary tumor. By light microscopy, the tumor cells were mostly basophilic and arranged in papillary architecture. Neither necrosis nor mitotic activity was observed (A hematoxylin-eosin, ×200). Immunohistochemistry staining was positive for ACTH (B immunoperoxidase, ×200) and transcription factor T-PIT (C immunoperoxidase, ×200). Cytoplasmic staining of SSTR2A was observed in around 1/3 tumor cells besides the strong staining of endothelial cells (D immunoperoxidase, ×200). The Ki-67 index was 10% (E immunoperoxidase, ×200). Cytokeratin CAM5.2 was diffusely positive in the cytoplasm (F immunoperoxidase, ×200). The positive control for ACTH and T-PIT was the human anterior pituitary gland, and for SSRT2, Ki-67 and CAM5.2 were cerebral cortex, tonsil and colonic mucosa, respectively Full size image The early onset and invasive behavior of this tumor led to the consideration of whether there was a genetic defect. Genetic studies were recommended for the families and they all agreed and signed the written informed consent forms. Whole exome sequencing (WES) was performed on the patient’s blood sample using an Illumina HiSeq sequencer to an average read depth of at least 90 times per individual. Raw sequence files were mapped to the GRCH37 human reference genome and analyzed using the Sentieon software. The results revealed a germline heterozygous GPR101 gene mutation c.505G > C (p.Gly169Arg), which was subsequently confirmed to be of maternal origin by Sanger sequencing. Meanwhile WES of the tumor tissue identified an additional somatic heterozygous c.2155_2157delTCC (p.S719del) mutation of the USP8 gene . Discussion and conclusions In this report, we described an extremely giant and invasive pituitary ACTH adenoma in a 10-year-old girl. According to Trouillas et al., invasive and proliferative pituitary tumors have a poor prognosis [5]. CD is rare among children, and the fast-growing and invasive nature of the tumor in this case led to the investigation of genetic causes. The somatic USP8 gene mutation has been recently reported to be associated with the pathogenesis of CD [6, 7]. This gene encodes ubiquitin-specific protease 8 (USP8). S718, S719 and P720 are hotspots in different studies [6,7,8,9,10,11,12,13,14]. They are located at the 14-3-3 binding motif, and the mutations disrupt the binding between USP8 and 14-3-3 protein, which leads to increased deubiquitination and EGFR signaling. High levels of EGFR consequently trigger proopiomelanocortin (POMC) transcription and ACTH secretion [6, 7]. The p.S719del mutation has been previously reported and its pathogenicity has been confirmed [7]. Thus, we speculate the p.S719del mutation plays a role in this patient with CD. It is noteworthy that in our case, the pituitary corticotrophin adenoma was extremely giant and bilaterally invasive. USP8 mutations have been found in 31% of pediatric CD patients [10]. It is well known that microadenomas are most common in adult and pediatric CD patients. Previously, the Chinese and Japanese cohorts observed smaller sizes of USP8-mutated PAs than wild-type PAs [7, 9]. The Chinese cohort also reported a lower rate of invasive adenomas in USP8-mutated PAs [7]. This may be explained by the finding that UPS8 mutations did not significantly promote cell proliferation more than the wild-type ones [6]. Other cohorts suggested no difference in tumor size or invasiveness between USP8-mutated and wild-type PAs [8, 10, 12,13,14], which may be partially explained by the differences in sample sizes and ethnic backgrounds. Owing to the lack of evidence of USP8 mutations significantly contributing to tumor growth and invasiveness, additional pathogenesis should be investigated in this case. The p.Gly169Arg mutation of the GPR101 gene has not been reported in patients with pituitary tumors. In silico predictions were performed using Polyphen-2, Mutation Taster and PROVEAN, and all of the programs reported it to be pathogenic. The GPR101 gene encodes an orphan G protein-coupled receptor (GPCR) and microduplication encompassing the gene has been proven to be the cause of X-linked acrogigantism (XLAG) [15]. XLAG is characterized by the early onset of pituitary GH-secreting macroadenomas. Point mutations of GPR101 have been found in patients with PAs that are mostly GH-secreting [15,16,17]. Although their prevalence is very low, an in vitro study supported the pathogenic role of p.E308D, the most common mutation of GPR101. This led to increased cell proliferation and GH production in rat pituitary GH3 cells [15]. Rare cases of PRL, ACTH or TSH-secreting PAs with GPR101 variants were also documented [16, 18]. To date, there have been five cases of ACTH-secreting PAs with four different germline GPR101 mutations: two cases of p.E308D, p.I122T, p.T293I and p.G31S, although in silico predictions and in vitro evaluations using AtT-20 cells have respectively determined the latter two mutations to be non-pathogenic [16, 18]. These patients were mainly children and young adults. Unlike pituitary GH-secreting tumors, the role of GPR101 mutations in the pathophysiology of CD is still questionable. Trivellin et al. demonstrated no statistically significant difference in GPR101 expression between corticotropinomas and normal human pituitaries. No significant correlation between GPR101 and POMC expression levels was found neither [18]. Given the evidences above, we hypothesize that the somatic USP8 mutation is responsible for the overexpression of ACTH in this CD girl while the germline GPR101 mutation contributes to the early onset and fast-growing nature of the tumor. Similarly, a 27-year-old woman with Nelson’s syndrome originally considered to be associated with a germline AIP variant (p.Arg304Gln) was recently reported to have a somatic USP8 mutation. The patient progressed rapidly and underwent multiple transsphenoidal surgeries [19]. Since germline AIP mutations are more commonly seen in GH-secreting PAs [20], the authors proposed that the USP8 mutation might have shifted the tumor towards ACTH-secreting [19]. Further investigations into the pathogenicity of GPR101 p.Gly169Arg and AIP p.Arg304Gln mutations are required to support the hypothesis. In summary, we report a novel germline GPR101 and somatic USP8 mutation in a girl with an extremely giant pituitary ACTH adenoma. The concurrent mutations may lead to the growth and function of the tumor, respectively. Further investigations should be carried out to verify the role of the concurrent mutations in the pathogenesis of pediatric CD. Availability of data and materials The WES data of the blood sample of the patient is available in the NGDC repository (https://ngdc.cncb.ac.cn/gsa-human/) and the accession number is HRA002396. Any additional information is available from the authors upon reasonable request. Abbreviations CD: Cushing’s disease ACTH: adrenocorticotropic hormone PA: pituitary adenoma NRS: numerical rating scale 24hUFC: 24-hour urine free cortisol LDDST: low-dose dexamethasone suppression test USP8: ubiquitin-specific protease 8 POMC: proopiomelanocortin GPCR: G protein-coupled receptor XLAG: X-linked acrogigantism References Weber A, Trainer PJ, Grossman AB, Afshar F, Medbak S, Perry LA, et al. Investigation, management and therapeutic outcome in 12 cases of childhood and adolescent Cushing’s syndrome. Clin Endocrinol (Oxf). 1995;43(1):19–28. CAS Article Google Scholar Storr HL, Alexandraki KI, Martin L, Isidori AM, Kaltsas GA, Monson JP, et al. Comparisons in the epidemiology, diagnostic features and cure rate by transsphenoidal surgery between paediatric and adult-onset Cushing’s disease. Eur J Endocrinol. 2011;164(5):667–74. CAS Article Google Scholar Magiakou MA, Mastorakos G, Oldfield EH, Gomez MT, Doppman JL, Cutler GB Jr, et al. Cushing’s syndrome in children and adolescents. Presentation, diagnosis, and therapy. N Engl J Med. 1994;331(10):629–36. CAS Article Google Scholar Hernández-Ramírez LC, Stratakis CA. Genetics of Cushing’s Syndrome. Endocrinol Metab Clin North Am. 2018;47(2):275–97. Article Google Scholar Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G, et al. A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol. 2013;126(1):123–35. Article Google Scholar Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, et al. Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet. 2015;47(1):31–8. CAS Article Google Scholar Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F, et al. Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res. 2015;25(3):306–17. CAS Article Google Scholar Perez-Rivas LG, Theodoropoulou M, Ferrau F, Nusser C, Kawaguchi K, Stratakis CA, et al. The Gene of the Ubiquitin-Specific Protease 8 Is Frequently Mutated in Adenomas Causing Cushing’s Disease. J Clin Endocrinol Metab. 2015;100(7):E997–1004. CAS Article Google Scholar Hayashi K, Inoshita N, Kawaguchi K, Ibrahim Ardisasmita A, Suzuki H, Fukuhara N, et al. The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol. 2016;174(2):213–26. CAS Article Google Scholar Faucz FR, Tirosh A, Tatsi C, Berthon A, Hernandez-Ramirez LC, Settas N, et al. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease. J Clin Endocrinol Metab. 2017;102(8):2836–43. Article Google Scholar Albani A, Perez-Rivas LG, Dimopoulou C, Zopp S, Colon-Bolea P, Roeber S, et al. The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf). 2018;89:454–8. CAS Article Google Scholar Ballmann C, Thiel A, Korah HE, Reis AC, Saeger W, Stepanow S, et al. USP8 Mutations in Pituitary Cushing Adenomas-Targeted Analysis by Next-Generation Sequencing. J Endocr Soc. 2018;2(3):266–78. CAS Article Google Scholar Losa M, Mortini P, Pagnano A, Detomas M, Cassarino MF, Pecori Giraldi F. Clinical characteristics and surgical outcome in USP8-mutated human adrenocorticotropic hormone-secreting pituitary adenomas. Endocrine. 2019;63(2):240–6. CAS Article Google Scholar Weigand I, Knobloch L, Flitsch J, Saeger W, Monoranu CM, Hofner K, et al. Impact of USP8 Gene Mutations on Protein Deregulation in Cushing Disease. J Clin Endocrinol Metab. 2019;104(7):2535–46. Article Google Scholar Trivellin G, Daly AF, Faucz FR, Yuan B, Rostomyan L, Larco DO, et al. Gigantism and acromegaly due to Xq26 microduplications and GPR101 mutation. N Engl J Med. 2014;371(25):2363–74. CAS Article Google Scholar Lecoq AL, Bouligand J, Hage M, Cazabat L, Salenave S, Linglart A, et al. Very low frequency of germline GPR101 genetic variation and no biallelic defects with AIP in a large cohort of patients with sporadic pituitary adenomas. Eur J Endocrinol. 2016;174(4):523–30. CAS Article Google Scholar Iacovazzo D, Caswell R, Bunce B, Jose S, Yuan B, Hernández-Ramírez LC, et al. Germline or somatic GPR101 duplication leads to X-linked acrogigantism: a clinico-pathological and genetic study. Acta Neuropathol Commun. 2016;4(1):56. Article Google Scholar Trivellin G, Correa RR, Batsis M, Faucz FR, Chittiboina P, Bjelobaba I, et al. Screening for GPR101 defects in pediatric pituitary corticotropinomas. Endocr Relat Cancer. 2016;23(5):357–65. CAS Article Google Scholar Perez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferrau F, et al. Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol. 2018;178(1):57–63. CAS Article Google Scholar Tatsi C, Stratakis CA. The Genetics of Pituitary Adenomas. J Clin Med. 2019;9(1). Download references Acknowledgements We thanked Dr. Xiaohua Shi and Dr. Yu Xiao from the Department of Pathology, Peking Union Medical College Hospital for their expertise in pituitary pathology and critical help in accomplishment of our manuscript. Funding This research was supported by “The National Key Research and Development Program of China” (No. 2016YFC0901501), “CAMS Innovation Fund for Medical Science” (CAMS-2017-I2M–1–011). They mainly covered the fees for genetic analysis and publications. Author information Authors and Affiliations Department of Pediatrics, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730, China Xu-dong Bao Department of Endocrinology, Key Laboratory of Endocrinology of National Health Commission, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730, China Lin Lu, Hui-juan Zhu, Xiao Zhai, Yong Fu, Feng-ying Gong & Zhao-lin Lu Department of Neurosurgery, Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College, Beijing, 100730, China Yong Yao, Ming Feng & Ren-zhi Wang Contributions XB and LL contributed to the study design and manuscript writing. HZ and FG performed genetic analysis. XZ and YF collected the clinical data. YY, MF and RW provided the tumor tissue and histopathology data. ZL revised the manuscript. All authors have read and approved the final manuscript. Corresponding author Correspondence to Lin Lu. Ethics declarations Ethics approval and consent to participate This study was approved by the Ethics Committee of Peking Union Medical College Hospital. The parents of the patient provided written informed consent for research participation. Consent for publication The parents of the patient provided written informed consent for the publication of indirectly identifiable data in this research. Competing interests The authors declare that they have no competing interests. Additional information Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Rights and permissions Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Reprints and Permissions From https://bmcendocrdisord.biomedcentral.com/articles/10.1186/s12902-022-01058-8
  23. Recordati Rare Diseases, a US biopharma that forms part of the wider Italian group, has presented multiple positive data sets on Isturisa (osilodrostat) at the annual ENDO 2022 meeting in Atlanta, Georgia. Isturisa is a cortisol synthesis inhibitor indicated for the treatment of adult patients with Cushing’s disease for whom pituitary surgery is not an option or has not been curative. Among the data presented, the Phase III LINC 4 study demonstrated that Isturisa maintained normal mean urinary free cortisol long-term in patients with Cushing’s disease while the Phase III LINC 3 study found adrenal hormone levels changed during early treatment with the drug while stabilizing during long-term treatment. The ILLUSTRATE study also showed patients treated with a prolonged titration interval tended to have greater persistence with therapy. Mohamed Ladha, president and general manager for North America, Recordati Rare Diseases, said: “The data from these studies reinforces the efficacy and safety of Isturisa as a treatment for patients with Cushing’s disease. “We are pleased to share these data with the endocrine community and are excited to provide patients with a much-needed step forward in the management of this rare, debilitating, and potentially life-threatening condition.” Cushing’s disease is a rare, serious illness caused by a pituitary tumor that leads to overproduction of cortisol by the adrenal glands. Excess cortisol can contribute to an increased risk of morbidity and mortality. Treatment for the condition seeks to lower cortisol levels to a normal range. Isturisa, which was approved by the US Food and Drug Administration in March 2020, works by inhibiting 11-beta-hydroxylase, an enzyme responsible for the final step of cortisol biosynthesis in the adrenal gland. From https://www.thepharmaletter.com/article/results-reinforce-efficacy-of-recordati-s-isturisa-in-cushing-s-disease
  24. MaryO'Note: I found this article very simplistic. What do you think? This article is for informational purposes only and is not a substitute for professional medical advice, diagnosis or treatment. Contact a qualified medical professional before engaging in any physical activity, or making any changes to your diet, medication or lifestyle. Imagine the heart-pounding rush of adrenaline you’d get while bungee jumping or zip lining — that’s what Angela Yawn felt all the time before receiving her diagnosis. In a span of six years, the 49-year-old gained 52 kg (115 lbs) and suffered from joint swelling, headaches, skin redness and a racing heart. “I would put my hand on my chest because it made me feel like that’s what I needed to do to hold my heart in,” Yawn, who lives in Griffin, U.S., told Today. “I noticed it during the day, but at night when I was trying to lie down and sleep, it was worse because I could do nothing but hear it beat, feel it thump.” Yawn recalled being the most frustrated with the weight gain, as she’d put on 1 kg (2 lbs) a day while only eating 600 calories. “I was going crazy,” she said. After dozens of doctors couldn’t piece together her seemingly unrelated symptoms, Yawn sought out the help of an endocrinologist in February 2021. Blood tests and an MRI confirmed that Yawn had a tumour in her pituitary gland — a small, pea-sized organ at the base of the brain — that caused the gland to release excess adrenocorticotropic hormones. As a result, she became inundated with cortisol, a steroid the body releases in response to danger or stress. This combination of factors led to her diagnosis — Cushing’s disease. Read on to learn more about Cushing’s disease, signs and symptoms as well as how it can be prevented. What is Cushing’s disease? “Cushing’s disease is a rare but serious condition that is caused by a pituitary tumour," a specialist from the University of California, Los Angeles (UCLA) pituitary team tells Yahoo Canada. "The gland releases excessive adrenocorticotropic hormones and cortisol into the blood over a long period of time. It’s a hormonal disorder that is sometimes called hypercortisolism, and you will need to see an endocrinologist or someone who specializes in hormonal-related diseases to confirm your diagnosis and to help you receive proper care.” Cushing’s disease is not the same as Cushing’s syndrome, which refers to elevated levels of cortisol in the blood and is much more common than Cushing’s disease. Unlike the disease, Cushing’s syndrome can be caused by taking medications that have cortisol such as prednisone, asthma inhalers and joint steroid injections. Who is at risk for Cushing’s disease? Cushing’s disease is incredibly rare, resulting in only 10 to 15 new cases per million people in the United States each year, according to UCLA Health. “It’s most commonly found in people between the ages of 20 and 50, and affects about three times more women than men,” the UCLA source, who asked not to be named, says. “However, you might be more at risk if you have high blood pressure, if you’re overweight or if you have type 2 diabetes.” What are the signs and symptoms of Cushing’s disease? Although each person may have a unique combination of symptoms, patients typically experience changes to their physical appearance, according to Mayo Clinic. “It’s very common to see rapid weight gain, red cheeks and bruising of the skin,” the UCLA source says. “I’ve also seen patients with generalized fatigue, depression, high blood pressure, a rapid heartbeat and loss of vision.” “The symptoms can seem random or unrelated, which is why it can be so hard to diagnose,” they add. To establish if you have the disease, your doctor will conduct a physical exam and ask you about your symptoms and medical history. Generally, the first step in diagnosing Cushing's disease is determining the state of excess cortisol in the blood. Afterwards, an MRI will determine if a pituitary tumour is visible. If you have symptoms of Cushing’s disease, you should make an appointment to see a doctor or endocrinologist. How is Cushing’s disease treated? In the last decade, treatment options have changed thanks to several breakthroughs in pituitary science. “Surgery to remove the tumour is normally the first treatment option. It’s minimally invasive, has a fairly high success rate and it’s the only long-term cure for Cushing’s disease at the moment,” explains the UCLA source. If surgery isn’t an option or doesn’t solve the problem, medication and radiation therapy are other ways to treat the disease. “No matter the stage of the disease at the time of diagnosis, treating it requires an experienced specialist or team of doctors familiar with pituitary tumours,” the UCLA source adds. How can I prevent Cushing’s disease? “There’s no tried and true method of preventing the condition,” the source explains. “But if you’re at risk or if you think you have the disease, I always recommend having a doctor monitor your cortisol levels on a regular basis.” The UCLA source also recommends implementing healthy lifestyle changes that can help prevent high blood pressure. Examples include reducing stress, getting adequate sleep, exercising regularly and eating a healthy diet that's rich in fruits, vegetables and whole grains. Adapted from https://ca.news.yahoo.com/what-is-cushings-disease-experts-warn-rare-serious-condition-120015725.html
  25. Abstract Cushing's disease causes numerous metabolic disorders, cognitive decline, and sarcopenia, leading to deterioration of the general health in older individuals. Cushing's disease can be treated with transsphenoidal surgery, but thus far, surgery has often been avoided in older patients. We herein report an older woman with Cushing's disease whose cognitive impairment and sarcopenia improved after transsphenoidal surgery. Although cognitive impairment and sarcopenia in most older patients show resistance to treatment, our case indicates that normalization of the cortisol level by transsphenoidal surgery can be effective in improving the cognitive impairment and muscle mass loss caused by Cushing's disease. References (27) 1. Lindholm J, Juul S, Jorgensen JO, et al. Incidence and late prognosis of Cushing's syndrome: a population-based study. J Clin Endocrinol Metab 86: 117-123, 2001. 2. Starkman MN. Neuropsychiatric findings in Cushing syndrome and exogenous glucocorticoid administration. Endocrinol Metab Clin N Am 42: 477-488, 2013. 3. Chen YF, Li YF, Chen X, Sun QF. Neuropsychiatric disorders and cognitive dysfunction in patients with Cushing's disease. CMJ 26: 3156-3160, 2013. 4. Priego T, Martín AI, González-Hedström D, Granado M, López-Calderón A. Role of hormones in sarcopenia. Vitam Horm 115: 535-570, 2021. 5. Grossman R, Mukherjee D, Chaichana KL, et al. Complications and death among elderly patients undergoing pituitary tumour surgery. Clin Endocrinol 73: 361-368, 2010. 6. Tiemensma J, Kokshoom NE, Biermasz NR, et al. Subtle cognitive impairments in patients with long-term cure of Cushing's disease. J Clin Endocrinol Metab 95: 2699-2714, 2010. 7. Brunetti A, Fulham MJ, Aloj L, et al. Decreased brain glucose utilization in patients with Cushing's disease. J Nucl Med 39: 786-790, 1998. 8. Liu S, Wang Y, Xu K, et al. Brain glucose metabolism is associated with hormone level in Cushing's disease: A voxel-based study using FDG-PET. Neuroimage Clin 12: 415-419, 2016. 9. Cheng H, Gao L, Hou B, et al. Reversibility of The cerebral blood flow in Patients with Cushing's Disease after Surgery Treatment. Metabolism 104: 154050, 2020. 10. Forget H, Lacroix A, Somma M, Cohen H. Cognitive decline in patients with Cushing's syndrome. J Int Neuropsychol Soc 6: 20-29, 2000. 11. Kim KJ, Filosa JA. Advanced in vitro approach to study neurovascular coupling mechanisms in the brain microcirculation. J Physiol 590: 1757-1770, 2012. 12. McEwen BS, Bowles NP, Gray JD, et al. Mechanisms of stress in the brain. Nat Neurosci 18: 1353-1363, 2015. 13. Rajkowska G, Miguel-Hidalgo JJ. Gliogenesis and glial pathology in depression. CNS Neurol Disord Drug Targets 6: 219-233, 2007. 14. Iuchi T, Akaike M, Mitsui T, et al. Glucocorticoid excess induces superoxide production in vascular endothelial cells and elicits vascular endothelial dysfunction. Circ Res 92: 81-87, 2003. 15. Cheng H, Gao L, Hou B, et al. Reversibility of the cerebral blood flow in patients with Cushing's disease after surgery treatment. Metabolism 104: 154050, 2020. 16. Frimodt-Møller KE, Møllegaard Jepsen JR, Feldt-Rasmussen U, et al. Hippocampal volume, cognitive functions, depression, anxiety, and quality of life in patients with Cushing syndrome. J Clin Endocrinol Metab 104: 4563-4577, 2019. 17. Siegel S, Kirstein CF, Grzywotz A, et al. Neuropsychological functioning in patients with cushing's disease and Cushing's syndrome. Exp Clin Endocrinol Diabetes 129: 194-202, 2021. 18. Chow Y, Masiak J, Mikołajewska E, et al. Limbic brain structures and burnout-A systematic review. Adv Med Sci 63: 192-198, 2018. 19. Starkman MN, Gebarski SS, Berent S, Schteingart DE. Hippocampal formation volume, memory dysfunction, and cortisol levels in patients with Cushing's syndrome. Biol Psychiatry 32: 756-765, 1992. 20. Goldberg AL, Tischler M, Demartina G, Griffin G. Hormonal regulation of protein degradation and synthesis in skeletal muscle. Fed Proc 39: 31-36, 1980. 21. Miller BS, Ignatoski KM, Daignault S, et al. A quantitative tool to assess degree of sarcopenia objectively in patients with hypercortisolism. Surgery 150: 1178-1185, 2011. 22. Delivanis D, Iñiguez-Ariza N, Zeb M, et al. Impact of hypercortisolism on skeletal muscle mass and adipose tissue mass in patients with adrenal adenomas. Clin Endocrinol 88: 209-216, 2018. 23. Kim JH, Kwak MK, Ahn SH, et al. Alteration in skeletal muscle mass in women with subclinical hypercortisolism. Endocrine 61: 134-143, 2018. 24. Gonzalez Rodriguez E, Marques-Vidal P, Aubry-Rozier B, et al. Diurnal salivary cortisol in sarcopenic postmenopausal women: the OsteoLaus Cohort. Calcif Tissue Int 109: 499-509, 2021. 25. Pivonello R, Fleseriu M, Newell-Price J, et al. Efficacy and safety of osilodrostat in patients with Cushing's disease (LINC 3): a multicentre phase III study with a double-blind, randomised withdrawal phase. Lancet Diabetes Endocrinol 8: 748-761, 2020. 26. Lau D, Rutledge C, Aghi MK. Cushing's disease: current medical therapies and molecular insights guiding future therapies. Neurosurg Focus 38: E11, 2015. 27. Villar-Taibo R, Díaz-Ortega C, Sifontes-Dubo M, et al. Pituitary surgery in elderly patients: a safe and effective procedure. Endocrine 2: 814-822, 2021. From https://www.jstage.jst.go.jp/article/internalmedicine/advpub/0/advpub_8326-21/_article
×
×
  • Create New...