Search the Community

Abstract Neuroendocrine carcinomas (NEC) of the cervix are a rare disease entity and account for only 1-2% of cervical carcinomas. The small-cell variant is the most common, with a worse prognosis and a higher rate of lymphatic and hematogenous metastases when compared with other subtypes of NEC. The diagnosis is usually made when the extra-pelvic disease is already apparent. Cushing’s syndrome due to adrenocorticotropic hormone (ACTH)-secreting tumors of the cervix is exceedingly rare. To date, there have been no reported cases in the literature of Cushing’s syndrome induced by the recurrence of metastases years after the initial diagnosis. This is a case of recurrent small-cell neuroendocrine carcinoma of the cervix presenting with Cushing’s syndrome five years after her original diagnosis. We present here the workup, management, and follow-up of this patient, including multisystemic, coordinated medical care. Introduction Neuroendocrine carcinomas (NECs) are heterogenous groups of tumors derived from neuroendocrine cells. NECs of the cervix are rare and account for 1-2% of all cervical carcinomas, with the small-cell variant being the most common [1,2]. Small-cell NECs have a high rate of lymphatic and hematogenous metastasis even when the carcinoma is limited to the cervix. Patients usually present at a late stage, with the extra-pelvic disease being apparent at the time of diagnosis [2]. Among the different histologic variants of NEC of the cervix, the small-cell variant has the highest rate of recurrence [3]. Adrenocorticotropic hormone (ACTH)-secreting tumors of the cervix are rare [4]. We present a case of recurrent metastatic NEC of the cervix five years after the original diagnosis of NEC of the cervix, now presenting with Cushing’s syndrome [1,2]. Case Presentation A 39-year-old female with a history of recurrent small-cell cervical cancer presented to the emergency department (ED) of our hospital with complaints of weight gain, generalized facial edema, lightheadedness, tingling sensation of her entire face, bilateral leg edema, and abdominal distention. Her problems started a month prior to her ED visit, when she started to complain of abdominal distention. She had a computed tomography (CT) abdomen with contrast, which revealed evidence of metastatic disease, including multiple large liver lesions (Figure 1). Subsequently, she had a positron emission tomography (PET) scan, which confirmed the presence of hypermetabolic lesions in the right peritonsillar tissue, liver, right lower quadrant of the abdomen, and bilateral pulmonary nodules with lymphadenopathy in the left hilum (Figure 2). A liver biopsy was done, with the final pathology consistent with recurrent NEC of the cervix. She was started on cisplatin, etoposide, and atezolizumab by gynecologic oncology but started to develop facial swelling and progressive abdominal distention, prompting this ED consult and subsequent admission. Figure 1: Abdomial CT with contrast done one month prior showed evidence of metastatic disease including multiple large liver lesions. Figure 2: PET/CT demonstrated the presence of hypermetabolic lesions in the liver and right lower quadrant of the abdomen. She had a significant medical history of being diagnosed with cervical cancer (FIGO stage 1B2 NEC) five years prior by gynecologic oncology, at which time she underwent concurrent chemo-radiation followed by surgical assessment of her pelvic lymph nodes with robotic pelvic lymph node dissection and bilateral ovarian transposition to avoid premature menopause. She was subsequently treated with cisplatin and pelvic radiation. She had a follow-up cervical biopsy several months after chemotherapy, which showed persistent NEC, but her PET scan showed no evidence of metastatic disease. After undergoing a robotic total laparoscopic hysterectomy, the final pathology showed a persistent microscopic focus of NEC of the cervix with negative margins. She received adjuvant chemotherapy with cisplatin and etoposide for six cycles with regular follow-up pap smears and annual PET scans, with no evidence of recurrence for five years. On admission, her vital signs were: blood pressure = 129/79 mm Hg, pulse rate = 85/min, respiratory rate = 18/min, and temperature = 98.5 °F (36.9 °C). Her physical examination was notable for moon facies (a noticeable change from her pictures as recent as two months prior), supraclavicular and dorsocervical fat pads, multiple bruises on her arms, edema of her face and legs, acne of her face and neck, and hair growth of her chin area. No purple striae were seen on the abdomen. Laboratory tests revealed leukopenia and thrombocytopenia (which were attributed to her chemotherapy), recently diagnosed diabetes (occasional hyperglycemia and HbA1c 7.7%), and electrolyte imbalances (hypokalemia and hypophosphatemia) (Table 1). Sodium 142 mEq/L (135–145 mEq/L) Potassium 2.0 mEq/L (3.5–5.0 mEq/L) Chloride 98 mEq/L (98–108 mEq/L) CO2 35 mEq/L (21–32 mEq/L) Anion gap 9 mEq/L (8–16 mEq/L) BUN 14 mg/dL (7–13 mEq/L) Creatinine 1.13 mg/dL (0.6–1.1 mg/dL) Glucose 460 mg/dL (74–100 mg/dL) Calcium 7.8 mg/dL (8.5–10.1 mg/dL) Phosphorous 1.0 mg/dL (2.5–4.5 mg/dL) Albumin 2.5 mg/dL (3.1–4.5 mg/dL) AST 43 U/L (15–27 U/L) ALT 76 U/L (12–78 U/L) White blood cell count 0.6 k/cmm (4.5–10.0 k/cmm) Red blood cell count 3.55 million cells/μL (3.7–5 × 2) Hemoglobin 11.9 g/dL (12.0–16.0) Hematocrit 34.3% (35.0–47.0) Platelet 45 k/cmm (150–440 k/cmm) Table 1: Initial laboratory work showed leukopenia, thrombocytopenia, hyperglycemia, hypokalemia, and hypophosphatemia. AST: aspartate aminotransferase, CO2: carbon dioxide, BUN: blood urea nitrogen, ALT: alanine aminotransferase. Her chest X-ray showed bilateral pleural effusions. Magnetic resonance imaging (MRI) of the brain showed no evidence of pituitary masses, abnormalities, or metastatic disease in the brain. A CT of the chest showed new bilateral non-calcified lung nodules when compared to the previous PET scan, pathologic-sized left hilar adenopathy, and multiple peripherally enhancing hepatic nodules and masses (Figure 3). The adrenal glands were unremarkable. Workup for facial swelling and bilateral leg edema showed no evidence of superior vena cava (SVC) syndrome on both her chest CT and transthoracic echocardiogram. Figure 3: Contrast-enhanced chest CT showing bilateral noncalcified lung nodules. She was admitted to the intensive care unit (ICU) and started on empiric antibiotics and filgrastim for neutropenia. Replacement therapy for both hypokalemia and hypophosphatemia was given. After both electrolytes were normalized, the patient was started on basal-bolus insulin therapy. Based on her clinic presentation of excessive weight gain, new-onset hyperglycemia, hypertension with hypokalemia, and a history of NEC, suspicion of Cushing’s syndrome was high. Further workup showed elevated serum cortisol after 1 mg overnight dexamethasone suppression, elevated 24-hour urine cortisol, and elevated midnight salivary cortisol, which confirmed Cushing’s syndrome (Table 2). ACTH was also elevated, but dehydroepiandrosterone sulfate (DHEAS) was normal. Thyroid function tests showed a slightly low free thyroxine, but this was attributed to an acute illness. HgbA1C 7.7% (4.0-6.0%) ACTH 1207 pg/mL (7.2–63.3 pg/mL) 24-hour urine cortisol 7070 μg/24 hr (6–42 μg/24 hr) Salivary cortisol >1.000 μg /dL (0.025–0.600 μg/dL) Serum cortisol after 1 mg overnight dexamethasone suppression 143.0 μg/dL (3.1–16.7 μg/dL) Total testosterone 77 ng/dL (14–76 ng/dL) DHEAS 250.0 μg/dL (57.3–279.2 μg/dL) Chromogranin A 970.9 ng/mL (0.0–101.8 ng/mL) TSH 0.572 mIU/L (0.358–3.74mIU/L) Free T4 0.70 ng/dl (0.76–1.46) ng/dl Table 2: Work up showed elevated ACTH, elevated 24-hour urine cortisol, elevated salivary cortisol, and elevated serum cortisol after 1 mg overnight dexamethasone suppression test. HgbA1C: hemoglobin A1C; ACTH: adrenocorticotropic hormone; DHEAS: dehydroepiandrosterone sulfate; TSH: thyroid stimulating hormone; free T4: free thyroxine. A diagnosis of Cushing's syndrome due to metastatic small-cell neuroendocrine carcinoma of the cervix was assumed. A bilateral adrenalectomy, which is the definitive treatment of hypercortisolism when surgical removal of the source of excess ACTH is done, was not done because gynecologic oncology wanted to treat her with chemotherapy urgently due to her metastases and the nature of the disease and felt that surgery and recovery would delay the start of chemotherapy. Ketoconazole was felt to be a poor choice in the setting of liver metastases with worsening liver function tests. The patient was thus started on mifepristone 300 mg daily, as it is indicated for hypercortisolism secondary to endogenous Cushing’s syndrome with diabetes. Nephrology was consulted, and potassium supplementation was transitioned to oral potassium chloride 40 meq tablets four times a day; spironolactone 50 mg twice daily was added for the hypokalemia and hypertension, which occurred after the patient started bevacizumab. Hypokalemia is a common side effect of mifepristone therapy due to the glucocorticoid receptor blockade, which leads to cortisol's spillover effect on unopposed mineralocorticoid receptors. She was discharged home with a basal-bolus insulin regimen. Her posthospitalization course was complicated by compression fractures of her lumbar spine one week after discharge with no history of falls. An MRI of the spine showed chronic compression fractures of the T11-L3 vertebral bodies with no evidence of osseous metastatic disease. Dual-energy X-ray absorptiometry (DXA) scan interpretation demonstrated osteoporosis. Vertebral fracture assessment showed morphometric fractures in the lower thoracic and upper lumbar vertebrae. She was subsequently treated with IV administration of 5 mg of zoledronic acid. She was also readmitted multiple times after her initial admission due to the patient's developing neutropenic fever, which was treated with filgrastim and antibiotics. After starting mifepristone, her glycemic control improved to the point that insulin therapy could be subsequently discontinued. Her liver enzymes normalized, and ketoconazole was subsequently added for adjunct therapy to treat hypercortisolism, but the dose could not be optimized due to persistently elevated liver function tests. Hypokalemia management and resistant hypertension were additional challenges encountered by this patient. At her follow-up visits, she had notably lost weight with the improvement of her leg edema. She continued to follow up with a nephrologist on an outpatient basis, and her normal potassium levels were normal on 40 meq of oral potassium chloride tablets four times a day and spironolactone 150 mg twice a day. She was followed up closely by her gynecologic oncologist and was on bevacizumab, topotecan, and paclitaxel before her unfortunate demise a few months later. Discussion Cushing’s syndrome due to ectopic ACTH secretion only represents 9-18% of cases. Most primary endocrine tumors responsible for ectopic ACTH secretion are located in the chest [5]. Abdominal and retroperitoneal neuroendocrine tumors are the second- and third-most reported sites [5]. Neuroendocrine tumors of the cervix are incredibly rare [6-9]. A unique feature of this case is that the patient presented with Cushing’s syndrome due to neuroendocrine tumor metastases found five years after the primary site of the tumor was resected. For this patient, a biopsy of the liver confirmed a metastatic neuroendocrine tumor, but it is unknown if the other sites of metastases are implicated in the production of excess ACTH. The management of this disease focuses on controlling hypercortisolism, consequent hyperglycemia, and hypokalemia. Surgical excision of ACTH-secreting neuroendocrine tumors is the most effective, but in cases where that is not possible, bilateral adrenalectomy and medical treatment are the next best treatments for this disease entity [10]. For this patient, bilateral adrenalectomy was not done as gynecologic oncology wanted to treat her with chemotherapy urgently due to the metastases and nature of the disease and felt that surgery and recovery would delay the start of chemotherapy. We provided medical management for the patient’s hypercortisolism. Pharmacological therapy for hypercortisolism can be categorized into immediate-acting steroidogenesis inhibitors (metyrapone, ketoconazole, and etomidate), slow-acting cortisol-lowering drugs (mitotane), and glucocorticoid receptor antagonists (mifepristone) [5]. We initially chose mifepristone because it is indicated in patients with type 2 diabetes mellitus and could be given safely despite the patient’s worsening liver function levels [11]. As demonstrated, the management of recurrent hypokalemia proved challenging in this patient. The phenomenon is well known to be induced by ectopic ACTH. Several mechanisms contribute to this. Activation of renal tubular type 1 (mineralocorticoid) receptors by cortisol is thought to be the mechanism that applies mainly to patients with severe hypercortisolism due to ectopic ACTH secretion. Additionally, there may also be an increase in the production of renin substrate from the liver. The high serum cortisol concentrations may not be completely inactivated by 11β-hydroxysteroid dehydrogenase type 2 in the kidney and overwhelm its ability to convert cortisol to cortisone, resulting in activation of mineralocorticoid receptors resulting in potassium loss in the distal tubules [12]. Hypokalemia may also result from adrenal hypersecretion of mineralocorticoids, such as deoxycorticosterone and corticosterone. This can also be amplified by mifepristone, as it is a glucocorticoid receptor antagonist that increases circulating cortisol levels [12]. Complications such as hypokalemia, hyperglycemia, acute respiratory distress syndrome, infections, muscle wasting, hypertension, and bone fractures can occur and can arise at any time throughout the course of the disease when urine-free cortisol is fivefold or more above the upper limit of normal [5]. Ketoconazole was initially considered for medical treatment, but due to mildly elevated liver enzymes during the initial presentation, we decided to use mifepristone instead. A small cohort study showed that severe hypercortisolism and increased baseline transaminase levels could be due to cortisol-induced hepatic steatosis [13]. Later in her course, ketoconazole was added to her mifepristone therapy to decrease adrenal cortisol production. Unfortunately, her dose could not be increased due to the patient's persistently elevated liver enzymes. Recurrent pancytopenia due to chemotherapy contributed to the protracted nature of this patient’s clinical course. Due to cortisol's immunosuppressive and anti-inflammatory effects, opportunistic infections can arise [14]. Since her initial hospitalization, she has been readmitted several times due to neutropenic fever, which was treated with filgrastim and antibiotics. Conclusions Ectopic Cushing’s syndrome due to metastatic neuroendocrine small-cell carcinoma is a rare condition with a poor prognosis. The options for treatment are few and not necessarily curative. There needs to be increased awareness of this serious and rare complication. Managing the condition can be a challenge and requires a multidisciplinary team approach to improve outcomes. References Cohen JG, Kapp DS, Shin JY, et al.: Small cell carcinoma of the cervix: treatment and survival outcomes of 188 patients. Am J Obstet Gynecol. 2010, 203:347.e1-6. 10.1016/j.ajog.2010.04.019 Salvo G, Gonzalez Martin A, Gonzales NR, Frumovitz M: Updates and management algorithm for neuroendocrine tumors of the uterine cervix. Int J Gynecol Cancer. 2019, 29:986-95. 10.1136/ijgc-2019-000504 Stecklein SR, Jhingran A, Burzawa J, Ramalingam P, Klopp AH, Eifel PJ, Frumovitz M: Patterns of recurrence and survival in neuroendocrine cervical cancer. Gynecol Oncol. 2016, 143:552-7. 10.1016/j.ygyno.2016.09.011 Chen J, Macdonald OK, Gaffney DK: Incidence, mortality, and prognostic factors of small cell carcinoma of the cervix. Obstet Gynecol. 2008, 111:1394-402. 10.1097/AOG.0b013e318173570b Young J, Haissaguerre M, Viera-Pinto O, Chabre O, Baudin E, Tabarin A: Management of Endocrine Disease: Cushing's syndrome due to ectopic ACTH secretion: an expert operational opinion. Eur J Endocrinol. 2020, 182:R29-58. 10.1530/EJE-19-0877 Hashi A, Yasumizu T, Yoda I, et al.: A case of small cell carcinoma of the uterine cervix presenting Cushing's syndrome. Gynecol Oncol. 1996, 61:427-31. 10.1006/gyno.1996.0168 Iemura K, Sonoda T, Hayakawa A, et al.: Small cell carcinoma of the uterine cervix showing Cushing's syndrome caused by ectopic adrenocorticotropin hormone production. Jpn J Clin Oncol. 1991, 21:293-8. Barghouthi N, Perini J, Cheng J: Ectopic adrenocorticotropic hormone production: a case of neuroendocrine cervical small cell carcinoma presenting as Cushing syndrome. AACE Clin Case Rep. 2018, 4:e367-e369. 10.4158/ACCR-2018-0080 Di Filippo L, Vitali G, Taccagni G, Pedica F, Guaschino G, Bosi E, Martinenghi S: Cervix neuroendocrine carcinoma presenting with severe hypokalemia and Cushing's syndrome. Endocrine. 2020, 67:318-20. 10.1007/s12020-020-02202-x Ilias I, Torpy DJ, Pacak K, Mullen N, Wesley RA, Nieman LK: Cushing's syndrome due to ectopic corticotropin secretion: twenty years' experience at the National Institutes of Health. J Clin Endocrinol Metab. 2005, 90:4955-62. 10.1210/jc.2004-2527 Biller BM, Grossman AB, Stewart PM, et al.: Treatment of adrenocorticotropin-dependent Cushing's syndrome: a consensus statement. J Clin Endocrinol Metab. 2008, 93:2454-62. 10.1210/jc.2007-2734 Fleseriu M, Biller BM, Findling JW, Molitch ME, Schteingart DE, Gross 😄 Mifepristone, a glucocorticoid receptor antagonist, produces clinical and metabolic benefits in patients with Cushing's syndrome. J Clin Endocrinol Metab. 2012, 97:2039-49. 10.1210/jc.2011-3350 Young J, Bertherat J, Vantyghem MC, Chabre O, Senoussi S, Chadarevian R, Castinetti F: Hepatic safety of ketoconazole in Cushing's syndrome: results of a Compassionate Use Programme in France. Eur J Endocrinol. 2018, 178:447-58. 10.1530/EJE-17-0886 Sarlis NJ, Chanock SJ, Nieman LK: Cortisolemic indices predict severe infections in Cushing syndrome due to ectopic production of adrenocorticotropin. J Clin Endocrinol Metab. 2000, 85:42-47. 10.1210/jcem.85.1.6294 From https://www.cureus.com/articles/111698-recurrent-neuroendocrine-tumor-of-the-cervix-presenting-with-ectopic-cushings-syndrome

Abstract Corticotroph macroadenomas are rare but difficult to manage intracranial neoplasms. Mutations in the two Cushing’s disease mutational hotspots USP8 and USP48 are less frequent in corticotroph macroadenomas and invasive tumors. There is evidence that TP53 mutations are not as rare as previously thought in these tumors. The aim of this study was to determine the prevalence of TP53 mutations in corticotroph tumors, with emphasis on macroadenomas, and their possible association with clinical and tumor characteristics. To this end, the entire TP53 coding region was sequenced in 86 functional corticotroph tumors (61 USP8 wild type; 66 macroadenomas) and the clinical characteristics of patients with TP53 mutant tumors were compared with TP53/USP8 wild type and USP8 mutant tumors. We found pathogenic TP53 variants in 9 corticotroph tumors (all macroadenomas and USP8 wild type). TP53 mutant tumors represented 14% of all functional corticotroph macroadenomas and 24% of all invasive tumors, were significantly larger and invasive, and had higher Ki67 indices and Knosp grades compared to wild type tumors. Patients with TP53 mutant tumors had undergone more therapeutic interventions, including radiation and bilateral adrenalectomy. In conclusion, pathogenic TP53 variants are more frequent than expected, representing a relevant amount of functional corticotroph macroadenomas and invasive tumors. TP53 mutations associated with more aggressive tumor features and difficult to manage disease. Introduction Pituitary neuroendocrine tumors are the second most common intracranial neoplasm [1]. They are usually benign, but when aggressive they may be particularly difficult to manage, accompanied by high comorbidity and increased mortality [2]. Corticotroph tumors constitute 6–10% of all pituitary tumors, but they represent up to 45% of aggressive pituitary tumors and pituitary carcinomas [2]. Functional corticotroph tumors cause Cushing’s disease (CD), a debilitating condition accompanied by increased morbidity and mortality due to glucocorticoid excess [3]. Pituitary surgery is the first line treatment, but recurrence is observed in 15–20% of cases of whom most are macroadenomas (with a size of ≥ 10 mm) [4]. Treatment options include repeated pituitary surgery, radiation therapy, medical treatment and bilateral adrenalectomy (BADX) [3]. With respect to the latter, corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome (CTP-BADX/NS) is a frequent severe complication and may present with aggressive tumor behavior [5,6,7]. Corticotroph tumors (including CTP-BADX/NS) carry recurrent somatic mutations in the USP8 gene in ~ 40–60% of cases [8,9,10,11,12,13]. These USP8 mutant tumors are usually found in female patients and are generally less invasive [8,9,10,11]. Additional genetic studies identified a second mutational hotspot in the USP48 gene, but no other driver mutations [14,15,16,17,18]. Focusing on USP8 wild type corticotroph tumors, we recently discovered TP53 mutations in 6 out of 18 cases (33%) [17]. Subsequent reports documented TP53 mutations in small series of mainly aggressive corticotroph tumors and carcinomas [19, 20]. TP53 is the most commonly mutated gene in malignant neoplasms [21, 22], including brain and neuroendocrine tumors [23, 24]. Until our previous report [17], TP53 mutations were only described in isolated cases of aggressive pituitary tumors and carcinomas, and were therefore considered very rare events [8, 16, 25,26,27,28]. A link between TP53 mutations and an aggressive corticotroph tumor phenotype has been hypothesized, but the heterogeneity and small size of the studies reported did not support significant clinical associations [17, 19]. To address this, we determined the prevalence of TP53 variants in a cohort of 86 patients with functional corticotroph tumors, including 61 with USP8 wild type tumors, and studied the associations between TP53 mutational status and clinical features. Methods Patients and samples We analyzed tumor samples of 86 adult patients: 61 USP8 wild type and 25 USP8 mutant. Sixty-six patients (46 females, 20 males) were diagnosed with CD between 1994 and 2020 in Germany (Hamburg, Munich, Erlangen, and Tübingen) and Luxembourg. Twenty additional patients (16 females, 4 males) were diagnosed with CTP-BADX/NS, operated and followed up in 7 different international centers (Nijmegen, Munich, Erlangen, Hamburg, Paris, Rio de Janeiro, and Würzburg). Twenty-three out of 86 samples were collected prospectively between 2018 and 2021, and 63 were retrospective cases (of which 42 were investigated in the context of USP8 and USP48 screenings and published elsewhere) [9, 12, 13, 17]. Seventy-one tumors were fresh frozen and 15 were formalin fixed paraffin embedded. Paired blood was available for 12 cases. The median follow-up time after initial diagnosis was 44 months (range 2–384 months). Endogenous Cushing’s syndrome was diagnosed according to typical clinical signs and symptoms and established biochemical procedures suggesting glucocorticoid excess. Clinical features included central obesity, moon face, buffalo hump, muscle weakness, easy bruising, striae, acne, low-impact bone fractures, mood changes, irregular menstruation, infertility and impotency. Biochemical diagnosis was based on increased 24 h urinary free cortisol (UFC) and late-night salivary cortisol levels, and lack of serum cortisol suppression after low-dose dexamethasone test. A pituitary ACTH source was confirmed by > 2.2 pmol/l (10 pg/ml) basal plasma ACTH, > 50% suppression of serum cortisol during an 8 mg dexamethasone test, and ACTH and cortisol response to corticotrophin releasing hormone stimulation. The clinical and pathological features of our study cohort are summarized in Additional file 1: Supplementary Table 1. All patients underwent pituitary surgery. The presence of an ACTH-producing pituitary tumor was confirmed histologically after surgical resection. Biochemical remission after surgery was defined as postoperative 24 h-UFC levels below or within the normal range, or serum cortisol levels < 5 µg/dl after low-dose (1 or 2 mg) dexamethasone suppression test. Tumor control was achieved when there was no evidence of regrowth or disease recurrence. Tumor invasion was defined as radiological or intraoperative evidence of tumor within the sphenoid and/or cavernous sinuses [29]. CTP-BADX/NS was defined as an expanding pituitary tumor after bilateral adrenalectomy (BADX) following expert consensus recommendations [5]. DNA extraction, TP53 amplification and sequencing Genomic DNA was extracted using the Maxwell Tissue DNA Kit (Promega), Maxwell Blood DNA kit (Promega) or the FFPE DNA mini kit (Qiagen), depending on the type of sample, as described previously [9, 12]. The entire coding sequence of TP53 (including exons 9β and 9γ) as well as noncoding regions adjacent to each exon were amplified using the GoTaq DNA polymerase (Promega) and specific primers (Additional file 1: Supplementary Table 2). Amplification of USP8 hotspot region and Sanger sequencing were performed as described previously [9, 12]. Chromatograms were analyzed using the Mutation Surveyor v4.0.9 (Soft Genetics). Samples were examined for TP53 coding and splicing variants. Variant position and pathogenicity was investigated in ENSEMBL (www.ensembl.org), the UCSC Genome Browser (http://genome-euro.ucsc.edu), the IARC TP53 database (https://p53.iarc.fr/TP53GeneVariations.aspx), the Catalogue Of Somatic Mutations in Cancer (COSMIC; https://cancer.sanger.ac.uk/cosmic), ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), PHANTM (http://mutantp53.broadinstitute.org/), the Human Splicing Finder (HSF; http://www.umd.be/HSF3/) and VarSEAK splicing predictor (https://varseak.bio/). Variant frequencies on the general population were obtained from the Allele Frequency Aggregator (ALFA) project [30], the Genome Aggregation Database (gnomAD) [31] and the International Genome Sample Resource 1000Genome project [32]. Throughout the text, variants refer to NC_000017.11 (genomic DNA), ENST00000269305.9 (coding DNA) and ENSP00000269305.4 (protein), following the Human Genome Variation Society (HGVS) standard nomenclature system. Statistical analysis Statistical analysis was performed with the software package SPSS v24 (IBM). We used t-test or one-way ANOVA to analyze the association of TP53 variants with age, body mass index; Mann–Whitney U and Kruskal–Wallis to test non-parametric variables, such as tumor size, hormone levels, Ki67 index and p53 score. We corrected the analysis for multiple comparisons with the Bonferroni test. Categorical variables were analyzed using a chi-square test or Fisher exact test when needed. Survival analysis was performed using Kaplan–Meier curves with log-rank tests, and multivariate Cox regression. An exact, two-tailed significance level of P < 0.05 was considered to be statistically significant. Results Analysis of TP53 nucleotide variants We analyzed all TP53 coding exons (including exons 9β and 9γ) and adjacent intronic noncoding sequences in 61 USP8 wild type tumors (49 CD and 12 CTP-BADX/NS). Of these, 13 were microadenomas (< 10 mm) and 48 macroadenomas (≥ 10 mm) at the time of the current operation. A separate group of 25 USP8 mutant tumors (17 CD and 8 CTP-BADX/NS) that were mainly macroadenomas (n = 19) was used for multiple comparison. We found 59 variants in our cohort: 30 exclusively in USP8 wild type, 21 in USP8 mutant, and 8 in wild type and mutant tumors regardless of USP8 mutational status. No indels in the coding region of TP53 were detected. In addition, we did not find any genetic variant affecting TP53 splicing. Nine out of 30 variants found in USP8 wild type tumors were either reported in the COSMIC database as pathogenic or absent from the common variant databases (1000Genomes, gnomAD, ALPHA) or had allele frequency < 0.0001. They were all described in cancer series: 5 as pathogenic or likely pathogenic in ClinVar, 2 as variants of uncertain significance (VUS) and 2 were not described in ClinVar (Table 1). All variants are reported to alter protein function and show clear loss of transactivation activity in a yeast based assay (Table 1) [33]. Table 1 Functionally relevant TP53 variants found in 9/86 corticotroph tumors Full size table Seven variants target amino acids within the DNA-binding domain, essential for p53 activity, disrupting S2’ and S7 β-sheets or the L3 loop spatial conformation. The other two [c.1009C > G (p.Arg337Gly) and c.1031 T > C (p.Leu344Pro)] locate in the tetramerization domain and keep p53 protein as monomer impairing its transactivation activity [34]. From the 9 variants, 8 affect highly conserved p53 residues, while in c.1031 T > C (p.Met133Lys) the methionine alternates with leucine or valine among species. This variant alters protein folding, probably reducing DNA affinity [35], while the substitution of a methionine that acts as an alternative start codon abolishes the transcription of isoforms ∆133p53α, ∆133p53β and ∆133p53γ. The 9 variants were detected in nine cases (henceforth referred to as TP53 mutant; Table 1). Two tumors from unrelated patients (#6 and #7) carried the same variant c.818G > A (p.Arg273His), while one tumor (#4) carried two variants (c.718A > G and c.773A > C). Seven variants were found in heterozygosis, while the other two (from patients #1 and #2) in homozygosis. From these two, we only had paired blood/tumor samples from patient #1 and detected the variant only on the tumor sample, indicative of loss of heterozygosity (Additional file 1: Supplementary Fig. 1A). Similarly, we could demonstrate the somatic origin of the TP53 variants in four other patients with paired tumor/blood samples (#3, #5, #6 and #9). The remaining 21/30 variants found in USP8 wild type and all 21 variants found in the USP8 mutant tumors were described as benign, likely benign or VUS with no evidence of affecting protein function. All tumors with these variants were considered TP53 wild type. From the 21 variants found in the USP8 wild type tumors (henceforth referred to as TP53/USP8 wild type group), 7 were non-synonymous variants, 8 synonymous variants and 6 non-coding variants without splicing effect. From the 21 variants found in the 25 USP8 mutant tumors, nine were synonymous, four non-synonymous and eight non-coding without splicing effect. In addition, eight variants were found in tumors regardless of USP8 mutational status that were not categorized as TP53 mutations. The intronic variant c.782 + 62G > A was found in heterozygosis in 6/70 samples. It was not reported in any database and is not predicted to have any splicing effect. The remaining seven are common variants classified as benign or likely benign in ClinVar and their allele frequencies were similar to those reported for the general population (ALFA, gnomAD and 1000Genome project) (Additional file 1: Supplementary Table 3). Summarizing, all TP53 mutations were found in the USP8 wild type tumors, leading to a prevalence of 15% in this subgroup. Clinical presentation of patients with TP53 mutant tumors Patients with TP53 mutant tumors (n = 9) tended to be diagnosed at older age compared to TP53/USP8 wild type tumors (n = 52) (t-test P = 0.069; Table 2). This was significant after including the USP8 mutant group (n = 25) in the multiple comparison analysis (ANOVA P = 0.024, Table 2) and when TP53/USP8 wild type and USP8 mutant tumors were combined to a single group (TP53 wild type, n = 77; Additional file 1: Supplementary Table 4. We did not observe any sex specific predominance of TP53 mutations in contrast to USP8 mutants that are predominantly found in female patients. Furthermore, we did not find any statistically significant differences in ACTH and cortisol levels (Table2; Additional file 1: Supplementary Table 4). Table 2 Clinical features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups Full size table Patients with TP53 mutant tumors underwent more surgeries and tumor resection was more frequently incomplete compared to TP53/USP8 wild type (Table 2). These patients also underwent a higher number of additional therapeutic procedures (radiation, n = 7; BADX, n = 4; temozolomide, n = 3; pasireotide, n = 2). Only one patient (#4) with TP53 mutant tumor, a 77 year-old man, had a single surgery without any other treatment, but his follow-up was short (< 6 months). We observed TP53 mutations more frequently in CTP-BADX/NS (4/12, 33%) compared to CD (5/49, 10%), trending towards statistically significant difference (Fischer exact test P = 0.065 for TP53 mutant vs. TP53/USP8 wild type, P = 0.060 for comparison among the 3 groups; Table 2). The TP53 mutant group associated with higher disease-specific mortality and shorter survival than USP8 mutant or TP53/USP8 wild type groups (log rank test, P = 0.023, Fig. 1). Three patients with TP53 mutant tumors (all CTP-BADX/NS) died of disease-related deaths: two from severe cerebral hemorrhage after surgery and stereotactic radiation and one from uncontrolled disease after five failed operations, radiotherapy (gamma knife, fractionated radiation) and chemotherapy (temozolomide, bevacizumab) at the ages of 75, 80 and 37, respectively. Ten-year survival was 27% for patients with TP53 mutant tumors, 100% for TP53/USP8 wild type and 86% for USP8 mutant. In our cohort, survival did not differ after adjusting for age (HR 7.7, 95%CI 0.6–107.7, P = 0.127). Fig. 1 Kaplan–Meier curve showing overall survival in patients with TP53 mutant/USP8 wild type, USP8 mutant/TP53 wild type, and TP53 wild type/USP8 wild type corticotroph tumors. The table underneath the graph shows the 10-year cumulative survival after diagnosis Full size image Tumor samples from prior surgeries were available from one TP53 mutant case (#8, Table 1). This male patient had his first pituitary surgery for CD when he was 30 years old and was treated with γ-knife one year later. He then underwent two more pituitary surgeries and BADX until the age of 35. He developed CTP-BADX/NS with para- and retrosellar tumor extension along with panhypopituitarism and underwent two more pituitary surgeries before dying at the age of 38 due to complications of the disease. We detected the TP53 variant c.1009C > G (p.Arg337Gly) in all available tumor specimens, including his first and latest surgeries (Additional file 1: Supplementary Fig. 1B). No statistical association was found between clinical data and any of the 8 common variants. Characteristics of TP53 mutant corticotroph tumors All TP53 mutations were found in macroadenomas (9/66; Table 3). TP53 mutant tumors were larger that TP53/USP8 wild type (mm median [IQR] 20.0 [14.0] vs. 15.0 [14.3]), but this did not reach statistical significance (Table 3). Multiple comparison analysis showed that the difference in tumor size is significant only comparing TP53 mutant with USP8 mutant (median [IQR] 23.3 [14.0] vs. 14 [7.3] mm; Kruskal–Wallis P = 0.019; Bonferroni corrected P = 0.018). Table 3 Tumor features of TP53 mutant versus TP53/USP8 wild type and USP8 mutant groups Full size table Parasellar invasion was reported in 34 out of 64 cases, for which this information was available, and it was more common in TP53 mutant tumors (100% vs. 53% and 55% for TP53/USP8 wild type and USP8 mutant, respectively; Fischer exact test P = 0.006). TP53 mutant tumors had higher Knosp grade (Kruskal–Wallis P = 0.011) with the majority being Knosp 4 (Table 3, Additional file 1: Supplementary Table 4). Ki67 proliferation index was available for 36 cases (6 TP53 mutant). Five out of six TP53 mutant tumors had Ki67 ≥ 3% and the overall Ki67 was higher than in the wild type tumors (Kruskal–Wallis P = 0.01; Bonferroni corrected P = 0.008 for TP53/USP8 wild type) (Table 3). Ki67 ≥ 10% was reported in 6 tumors, from which 5 were TP53 mutant (Fischer exact test P < 0.0001; the remaining case was TP53/USP8 wild type). We had information on p53 immunostaining from 9 cases (all macroadenomas), four of which TP53 mutant: 3 tumors (from patients #5, 6 and 9) showed high p53 immunoreactivity, while the one (from patient #3) carrying a nonsense variant leading to a truncated protein was p53 negative. The five TP53 wild type cases showed isolated nuclear staining in < 1–3% of cells. Summarizing, TP53 mutations were significantly associated with features related to a more aggressive tumor behavior, such as incomplete tumor resection, more frequent parasellar invasion, higher Knosp grade, and higher Ki67 proliferation index (Table 3; Additional file 1: Supplementary Table 4). Discussion Herein, we investigated the prevalence of TP53 mutations by screening a large cohort of 61 functional corticotroph tumors with USP8 wild type status, and found variants altering protein function in 15% of cases. We did not detect TP53 mutations in a separate group of 25 USP8 mutant tumors, which is in concordance with previously published small next-generation sequencing series [8, 18, 19]. Since we focused on USP8 wild type tumors, macroadenomas were overrepresented in our cohort. Consequently, it should be noted that the prevalence of TP53 mutations is expected to be lower in the general CD population. In fact, ~ 50% of corticotroph tumors carry USP8 mutations, which others and we have shown to be mutually exclusive. Corticotroph tumors with USP8 mutations are associated with female predominance, younger age at presentation, and less invasiveness (despite shorter time to relapse) [9, 11, 13, 18, 36]. In contrast, TP53 mutant tumors were diagnosed mostly at older age, did not show sex predominance and were larger and more invasive, with lower complete resection rate. None of the 19 microadenomas included in our study carried TP53 mutations. Still, we need to acknowledge that since no sample was microdissected we may have lost microadenoma cases with TP53 mutations. Instead, we found TP53 mutations in 9/66 macroadenomas (14%) and 8/34 (24%) invasive tumors, supporting the findings from smaller series [17, 19]. Tumor size at presentation or invasiveness do not reliably predict aggressiveness. Instead, the European Society of Endocrinology Clinical Practice Guidelines for the management of aggressive pituitary tumors and carcinomas proposed a definition of pituitary tumor aggressiveness based on rapid or clinically relevant tumor growth despite optimal therapeutic options, along with bone invasion [37]. A recent study in a series of 9 aggressive pituitary tumors and carcinomas carrying ATRX mutations reported a high frequency of missense TP53 variants (5/9, 55.6%), further suggesting a link between TP53 mutational status and unfavorable outcome [20]. We do not have exact information on changes of tumor growth for the majority of our cases, but the higher number of surgical and radiation interventions, the higher Knosp grades, and the increased mortality rate indicate that patients with TP53 mutant tumors obviously follow a more aggressive disease course. Ki67 proliferation index together with p53 immunostaining and mitotic count have been suggested as histological markers of pituitary tumor aggressiveness [29, 38]. In our series, Ki67 was significantly higher in TP53 mutant tumors, reinforcing our prior observation of a higher proportion of TP53 mutant tumors in the Ki67 ≥ 3 group [17]. We had limited information on p53 immunohistochemistry, since this measure is not routinely performed in our collaborative centers. Nevertheless, in the few tumors with known p53 immunopositivity, it was higher in the TP53 mutant group, which is in concordance with a previous study reporting high p53 immunoreactivity in all TP53 mutant tumors [19]. A mutagenic action of radiation on TP53 has been hypothesized by small series on radiation-induced tumors. For instance, TP53 mutations were reported in 58% of radiation-induced sarcomas [39], while a meta-analysis reported TP53 mutations in 14/30 radiation-induced gliomas [40]. A previous study reported a case with frameshift TP53 mutation in the CTP-BADX/NS tumor, but not in the initial CD surgeries, and the mutation was therefore suspected to be induced by radiotherapy [41]. In our series, however, 4 out of 7 TP53 mutant tumors were obtained before radiation. In their case report, Pinto et al. suggested that TP53 mutations are acquired during tumorigenesis and condition tumor evolution [41]. In contrast, Casar-Borota et al. and Uzilov et al. reported high allele fraction of TP53 mutations, indicating that they are not a late event in corticotroph tumorigenesis [19, 20]. In addition, Uzilov et al. reported TP53 mutations in all tumor specimens from their two TP53 mutant cases with multiple surgeries [19]. Similarly, in our series we had tissue from multiple pituitary surgeries from one patient and found the TP53 variant in all samples (CD and CTP-BADX/NS), including specimens obtained before radiotherapy. Taken together, these observations suggest that in most cases, TP53 mutations may appear early during tumor development. A limitation of our study is the short follow-up of patients who were prospectively included. Moreover, material from repeated surgeries was lacking from most patients with TP53 mutant tumors, hampering the examination of tumor evolution in these patients. Similarly, we had limited access to blood samples, so we could not demonstrate the somatic origin for all variants. Nevertheless, the older age at initial diagnosis of CD in patients with TP53 mutant tumors (53 ± 19.5 years old, with the youngest patient diagnosed at the age of 30) and the absence of additional neoplasias during follow-up also support a somatic instead of a germline origin. Furthermore, conditions related to germline TP53 mutations, such as Li-Fraumeni syndrome, very rarely present with pituitary tumor [42]. To our knowledge, the only published case so far was a pediatric patient with an aggressive lactotroph tumor [43]. In addition to the TP53 mutations, we detected several common variants. Variants rs59758982 and rs1042522 have been associated with increased cancer susceptibility [44, 45]. In some cancer types, the very frequent rs1042522 c.215G > C (p.Pro72Arg) alternative variant correlated to more efficient induction of apoptosis by DNA-damaging chemotherapeutic drugs, growth suppression and higher metastatic potential [46,47,48]. In nonfunctioning pituitary tumors, alternative allele C (leading to p.Arg72) was related to early age at presentation and reduced p21 expression [49]. Very recently, an overrepresentation of the rs1042522 alternative allele C (p.Arg72) was reported in 9 out of 10 corticotroph neoplasias including 5 functional tumors (allele frequency 0.900, vs 0.714 in Latino/admixed American in gnomAD [31]) without any association with clinical features [50]. In our cohort, we did not detect different allele frequencies in any of the investigated common variants (including rs1042522) compared with public databases, nor statistical association with any clinical variable, rendering their contribution to corticotroph pathophysiology unlikely. Conclusion Screening a large corticotroph tumor series revealed that TP53 mutations are more frequent than previously considered. Furthermore, we show that patients with TP53 mutant tumors had higher number of surgeries, more invasive tumors, and worse disease outcome. Our study provides evidence that patients with pathogenic or function altering variants may require more intense treatment and extended follow-up, and suggests screening for TP53 variants in macroadenomas with wild type USP8 status. Further work is needed to determine the potential use of TP53 status as a predictor of disease outcome. Availability of data and materials The authors declare that the relevant data supporting the conclusions of this article are included within the article and its supplementary information file. Additional clinical data are available from the corresponding authors MT and LGPR upon reasonable request. Abbreviations CD: Cushing’s disease BADX: Bilateral adrenalectomy CTP-BADX/NS: Corticotroph tumor progression after bilateral adrenalectomy/Nelson’s syndrome ACTH: Adrenocorticotropic hormone SD: Standard deviation IQR: Interquartile range HR: Hazard ratio References Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS (2018) CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011–2015. Neuro Oncol 20:iv1-86 PubMed PubMed Central Article Google Scholar McCormack A, Dekkers OM, Petersenn S, Popovic V, Trouillas J, Raverot G et al (2018) Treatment of aggressive pituitary tumours and carcinomas: results of a European society of endocrinology (ESE) survey 2016. Eur J Endocrinol 178:265–276 CAS PubMed Article Google Scholar Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR et al (2021) Consensus on diagnosis and management of Cushing’s disease: a guideline update. Lancet Diabetes Endocrinol 9:847–875 PubMed Article Google Scholar Dimopoulou C, Schopohl J, Rachinger W, Buchfelder M, Honegger J, Reincke M et al (2013) Long-term remission and recurrence rates after first and second transsphenoidal surgery for Cushing’s disease: care reality in the Munich metropolitan region. Eur J Endocrinol 170:283–292 PubMed Article CAS Google Scholar Reincke M, Albani A, Assie G, Bancos I, Brue T, Buchfelder M et al (2021) Corticotroph tumor progression after bilateral adrenalectomy (Nelson’s syndrome): systematic review and expert consensus recommendations. Eur J Endocrinol 184:P1-16 CAS PubMed PubMed Central Article Google Scholar Fountas A, Lim ES, Drake WM, Powlson AS, Gurnell M, Martin NM et al (2020) Outcomes of patients with Nelson’s syndrome after primary treatment: a multicenter study from 13 UK pituitary centers. J Clin Endocrinol Metab 105:1527–1537 Article Google Scholar Kemink SA, Wesseling P, Pieters GF, Verhofstad AA, Hermus AR, Smals AG (1999) Progression of a Nelson’s adenoma to pituitary carcinoma; a case report and review of the literature. J Endocrinol Invest 22:70–75 CAS PubMed Article Google Scholar Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F et al (2015) Mutations in the deubiquitinase gene USP8 cause Cushing’s disease. Nat Genet 47:31–38 CAS PubMed Article Google Scholar Pérez-Rivas LG, Theodoropoulou M, Ferraù F, Nusser C, Kawaguchi K, Stratakis CA et al (2015) The Gene of the ubiquitin-specific protease 8 is frequently mutated in adenomas causing Cushing’s disease. J Clin Endocrinol Metab 100:E997-1004 PubMed PubMed Central Article Google Scholar Ma Z-Y, Song Z-J, Chen J-H, Wang Y-F, Li S-Q, Zhou L-F et al (2015) Recurrent gain-of-function USP8 mutations in Cushing’s disease. Cell Res 25:306–317 CAS PubMed PubMed Central Article Google Scholar Hayashi K, Inoshita N, Kawaguchi K, Ardisasmita AI, Suzuki H, Fukuhara N et al (2016) The USP8 mutational status may predict drug susceptibility in corticotroph adenomas of Cushing’s disease. Eur J Endocrinol 174:213–226 CAS PubMed Article Google Scholar Pérez-Rivas LG, Theodoropoulou M, Puar TH, Fazel J, Stieg MR, Ferraù F et al (2018) Somatic USP8 mutations are frequent events in corticotroph tumor progression causing Nelson’s tumor. Eur J Endocrinol 178:59–65 Article Google Scholar Albani A, Pérez-Rivas LG, Dimopoulou C, Zopp S, Colón-Bolea P, Roeber S et al (2018) The USP8 mutational status may predict long-term remission in patients with Cushing’s disease. Clin Endocrinol (Oxf) 89:454–458 CAS Article Google Scholar Bi WL, Horowitz P, Greenwald NF, Abedalthagafi M, Agarwalla PK, Gibson WJ et al (2017) Landscape of genomic alterations in pituitary adenomas. Clin Cancer Res 23:1841–1851 CAS PubMed Article Google Scholar Song Z-J, Reitman ZJ, Ma Z-Y, Chen J-H, Zhang Q-L, Shou X-F et al (2016) The genome-wide mutational landscape of pituitary adenomas. Cell Res 26:1255–1259 CAS PubMed PubMed Central Article Google Scholar Chen J, Jian X, Deng S, Ma Z, Shou X, Shen Y et al (2018) Identification of recurrent USP48 and BRAF mutations in Cushing’s disease. Nat Commun 9:3171 PubMed PubMed Central Article CAS Google Scholar Sbiera S, Perez-Rivas LG, Taranets L, Weigand I, Flitsch J, Graf E et al (2019) Driver mutations in USP8 wild-type Cushing’s disease. Neuro Oncol 21:1273–1283 CAS PubMed PubMed Central Article Google Scholar Neou M, Villa C, Armignacco R, Jouinot A, Raffin-Sanson ML, Septier A et al (2020) Pangenomic classification of pituitary neuroendocrine tumors. Cancer Cell 37:123-134.e5 CAS PubMed Article Google Scholar Uzilov AV, Taik P, Cheesman KC, Javanmard P, Ying K, Roehnelt A et al (2021) USP8 and TP53 drivers are associated with CNV in a corticotroph adenoma cohort enriched for aggressive tumors. J Clin Endocrinol Metab 106:826–842 PubMed Article Google Scholar Casar-Borota O, Boldt HB, Engström BE, Andersen MS, Baussart B, Bengtsson D et al (2021) Corticotroph aggressive pituitary tumors and carcinomas frequently harbor ATRX mutations. J Clin Endocrinol Metab 106:1183–1194 PubMed Article Google Scholar Campbell PJ, Getz G, Korbel JO, Stuart JM, Jennings JL, Stein LD et al (2020) Pan-cancer analysis of whole genomes. Nature 578:82–93 Article CAS Google Scholar Bouaoun L, Sonkin D, Ardin M, Hollstein M, Byrnes G, Zavadil J et al (2016) TP53 variations in human cancers: new lessons from the IARC TP53 database and genomics data. Hum Mutat 37:865–876 CAS PubMed Article Google Scholar Horbinski C, Ligon KL, Brastianos P, Huse JT, Venere M, Chang S et al (2019) The medical necessity of advanced molecular testing in the diagnosis and treatment of brain tumor patients. Neuro Oncol 21:1498–1508 CAS PubMed PubMed Central Article Google Scholar van Riet J, van de Werken HJG, Cuppen E, Eskens FALM, Tesselaar M, van Veenendaal LM et al (2021) The genomic landscape of 85 advanced neuroendocrine neoplasms reveals subtype-heterogeneity and potential therapeutic targets. Nat Commun 12:4612 PubMed PubMed Central Article CAS Google Scholar Herman V, Drazin NZ, Gonsky R, Melmed S (1993) Molecular screening of pituitary adenomas for gene mutations and rearrangements. J Clin Endocrinol Metab 77:50–55 CAS PubMed Google Scholar Levy A, Hall L, Yeudall WA, Lightman SL (1994) p53 gene mutations in pituitary adenomas: rare events. Clin Endocrinol (Oxf) 41:809–814 CAS Article Google Scholar Tanizaki Y, Jin L, Scheithauer BW, Kovacs K, Roncaroli F, Lloyd RV (2007) P53 gene mutations in pituitary carcinomas. Endocr Pathol 18:217–222 CAS PubMed Article Google Scholar Kawashima ST, Usui T, Sano T, Iogawa H, Hagiwara H, Tamanaha T et al (2009) P53 gene mutation in an atypical corticotroph adenoma with Cushing’s disease. Clin Endocrinol (Oxf) 2009:656–657 Article Google Scholar Trouillas J, Roy P, Sturm N, Dantony E, Cortet-Rudelli C, Viennet G et al (2013) A new prognostic clinicopathological classification of pituitary adenomas: a multicentric case-control study of 410 patients with 8 years post-operative follow-up. Acta Neuropathol 126:123–135 PubMed Article Google Scholar Phan J, Jin Y, Zhang H, Qiang W, Shekhtman E, Shao D et al (2020) ALFA: allele frequency aggregator: national center for biotechnology information, U.S. National Library of Medicine. Available from www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa/ Karczewski KJ, Francioli LC, Tiao G, Cummings BB, Alföldi J, Wang Q et al (2020) The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581:434–443 CAS PubMed PubMed Central Article Google Scholar Fairley S, Lowy-Gallego E, Perry E, Flicek P (2020) The International genome sample resource (IGSR) collection of open human genomic variation resources. Nucleic Acids Res 48:D941–D947 CAS PubMed Article Google Scholar Kato S, Han S-Y, Liu W, Otsuka K, Shibata H, Kanamaru R et al (2003) Understanding the function–structure and function–mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci 100:8424–8429 CAS PubMed PubMed Central Article Google Scholar Kawaguchi T, Kato S, Otsuka K, Watanabe G, Kumabe T, Tominaga T et al (2005) The relationship among p53 oligomer formation, structure and transcriptional activity using a comprehensive missense mutation library. Oncogene 24:6976–6981 CAS PubMed Article Google Scholar Greenblatt MS, Chappuis PO, Bond JP, Hamel N, Foulkes WD (2001) TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res 61:4092–4097 CAS PubMed Google Scholar Sesta A, Cassarino MF, Terreni M, Ambrogio AG, Libera L, Bardelli D et al (2020) Ubiquitin-Specific Protease 8 mutant corticotrope adenomas present unique secretory and molecular features and shed light on the role of ubiquitylation on ACTH processing. Neuroendocrinology 110:119–129 CAS PubMed Article Google Scholar Raverot G, Burman P, McCormack A, Heaney A, Petersenn S, Popovic V et al (2018) European society of endocrinology clinical practice guidelines for the management of aggressive pituitary tumours and carcinomas. Eur J Endocrinol 178:G1-24 CAS PubMed Article Google Scholar Thapar K, Scheithauer BW, Kovacs K, Pernicone PJ, Laws ER (1996) p53 expression in pituitary adenomas and carcinomas: correlation with invasiveness and tumor growth fractions. Neurosurgery 38:765–70 CAS PubMed Article Google Scholar Gonin-Laurent N, Gibaud A, Huygue M, Lefèvre SH, Le Bras M, Chauveinc L et al (2006) Specific TP53 mutation pattern in radiation-induced sarcomas. Carcinogenesis 27:1266–1272 CAS PubMed Article Google Scholar Whitehouse JP, Howlett M, Federico A, Kool M, Endersby R, Gottardo NG (2021) Defining the molecular features of radiation-induced glioma: a systematic review and meta-analysis. Neuro-Oncol Adv 3:1–16 Google Scholar Pinto EM, Siqueira SACC, Cukier P, Fragoso MCBVCBV, Lin CJ, De Mendonca BB et al (2011) Possible role of a radiation-induced p53 mutation in a Nelson’s syndrome patient with a fatal outcome. Pituitary 14:400–404 PubMed Article Google Scholar Orr BA, Clay MR, Pinto EM, Kesserwan C (2020) An update on the central nervous system manifestations of Li–Fraumeni syndrome. Acta Neuropathol 139:669–87 CAS PubMed Article Google Scholar Birk H, Kandregula S, Cuevas-Ocampo A, Wang CJ, Kosty J, Notarianni C (2022) Pediatric pituitary adenoma and medulloblastoma in the setting of p53 mutation: case report and review of the literature. Childs Nerv Syst. https://doi.org/10.1007/s00381-022-05478-8 Article Google Scholar Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS (2004) Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 210:151–157 CAS PubMed Article Google Scholar Sagne C, Marcel V, Amadou A, Hainaut P, Olivier M, Hall J (2013) A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): geographic and tumor-specific effects. Cell Death Dis 4:e492 CAS PubMed PubMed Central Article Google Scholar Katkoori VR, Jia X, Shanmugam C, Wan W, Meleth S, Bumpers H et al (2009) Prognostic significance of p53 Codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clin Cancer Res 15:2406–2416 CAS PubMed PubMed Central Article Google Scholar Dumont P, Leu JIJ, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33:357–365 CAS PubMed Article Google Scholar Basu S, Gnanapradeepan K, Barnoud T, Kung CP, Tavecchio M, Scott J et al (2018) Mutant p53 controls tumor metabolism and metastasis by regulating PGC-1α. Genes Dev 32:230–243 CAS PubMed PubMed Central Article Google Scholar Yagnik G, Jahangiri A, Chen R, Wagner JR, Aghi MK (2017) Role of a p53 polymorphism in the development of nonfunctional pituitary adenomas. Mol Cell Endocrinol 446:81–90 CAS PubMed PubMed Central Article Google Scholar Andonegui-Elguera S, Silva-Román G, Peña-Martínez E, Taniguchi-Ponciano K, Vela-Patiño S, Remba-Shapiro I et al (2022) The genomic landscape of corticotroph tumors: from silent adenomas to ACTH-secreting carcinomas. Int J Mol Sci. 23:4861 CAS PubMed PubMed Central Article Google Scholar Download references Funding Open Access funding enabled and organized by Projekt DEAL. The study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Project number: 314061271-TRR 205 to MF, MR and MT; FA 466/5-1 to MF; DE 2657/1-1 to TD), Metiphys program of the LMU Medical Faculty (to AA), Else Kröner-Fresenius Stiftung (Project number: 2012_A103 and 2015_A228 to MR) and Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ; Project number: E-26/211.294/2021 to MRG). Author information Authors and Affiliations Medizinische Klinik und Poliklinik IV, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, Germany Luis Gustavo Perez-Rivas, Julia Simon, Adriana Albani, Sicheng Tang, Günter K. Stalla, Martin Reincke & Marily Theodoropoulou Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, Munich, Germany Sigrun Roeber & Jochen Herms Department of Endocrinology, Center for Rare Adrenal Diseases, Assistance Publique-Hôpitaux de Paris, Hôpital Cochin, Paris, France Guillaume Assié Université de Paris, Institut Cochin, Inserm U1016, CNRS UMR8104, F-75014, Paris, France Guillaume Assié Division of Endocrinology and Diabetes, Department of Internal Medicine I, University Hospital, University of Würzburg, Würzburg, Germany Timo Deutschbein & Martin Fassnacht Medicover Oldenburg MVZ, Oldenburg, Germany Timo Deutschbein Division of Endocrinology, Hospital Universitário Clementino Fraga Filho, Rio de Janeiro, Brazil Monica R. Gadelha Division of Endocrinology, Department of Internal Medicine, Radboud University Medical Centre, Nijmegen, The Netherlands Ad R. Hermus Medicover Neuroendocrinology, Munich, Germany Günter K. Stalla Service d’Endocrinologie, Centre Hospitalier du Nord, Ettelbruck, Luxembourg Maria A. Tichomirowa Department of Neurosurgery, Universitätskrankenhaus Hamburg-Eppendorf, Hamburg, Germany Roman Rotermund & Jörg Flitsch Department of Neurosurgery, University of Erlangen-Nürnberg, Erlangen, Germany Michael Buchfelder Department of Neurosurgery, University of Tübingen, Tübingen, Germany Isabella Nasi-Kordhishti & Jürgen Honegger Neurochirurgische Klinik und Poliklinik, Klinikum der Universität München, Ludwig-Maximilians-Universität München, Munich, Germany Jun Thorsteinsdottir Institute of Neuropathology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany Wolfgang Saeger Contributions LPGR and MT designed the study. LPGR, JS, AA and ST implemented the study. LGPR did the data analysis. SR, GA, TD, MF, MRG, ARH, GKS, MAT, RR, JF, MB, INK, JH, JT, WS, JH and MR provided patient materials and data. LGPR and MT interpreted the data and composed the main draft of the manuscript. All authors have seen, corrected and approved the final draft. Corresponding authors Correspondence to Luis Gustavo Perez-Rivas or Marily Theodoropoulou. Ethics declarations Ethics approval and consent to participate The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of the LMU Munich (Nr. 643-16). All patients provided written informed consent. Competing interests The authors declare that they have no competing interests. Additional information Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Supplementary Information Additional file 1 of TP53 mutations in functional corticotroph tumors are linked to invasion and worse clinical outcome Skip to file navigationSkip to generic navigation 1 Supplementary Table 1 . Description of study cohort. Variable mean/median SD/IQR Total n Age at diagnosis (years), mean ±SD, [total n] 42 ±15.2 86 Sex (female), n (%), [total n] 62 (72%) 86 BMI (kg/m2), mean ±SD, [total n] 28.9 ±6.3 74 Disease presentation, n (%), [total n] 86 Cushing 66 (77%) Nelson 20 (23%) Number of prior pituitary surgeries, n (%), [total n] 80 0 50 (63%) 1 23 (29%) ≥2 7 (9%) Total number of pituitary surgeries, n (%), [total n] 82 1 46 (56%) 2 23 (28%) ≥3 13 (16%) Complete tumor resection, n (%), [total n] 32 (60%) 53 Postoperative remission, n (%), [total n] 46 (59%) 78 Postoperative tumor control, n (%), [total n] 34 (60%) 57 Radiation therapy, n (%), [total n] 24 (34%) 70 Radiation therapy before sample collection, n (%), [total n] 7 (13%) 53 Bilateral adrenalectomy, n (%), [total n] 23 (27%) 86 Pharmacological treatments a , n (%), [total n] 18 (42%) 43 Preoperative hormone levels Plasma ACTH (pg/mL), median (IQR) 98 (570.4) 75 Serum cortisol ( μ g/dl), median (range) 29.1 (168.6) 50 24h - urinary free cortisol ( μ g/24h), median (range) 432.5 (598.3) 30 Serum cortisol after low - dose DST ( μ g/dl), median (IQR) 20 (20.7) 46 Postoperative hormone levels Plasma ACTH (pg/mL), median (IQR) 20 (107.6) 57 Serum cortisol nadir ( μ g/dl), median (range) 8.8 (19.4) 58 Tumo r size (mm), median (IQR), [total n] 15 (13.0) 85 Microadenoma 19 (22%) Macroadenoma 66 (78%) Granulation, n (%), [total n] 30 Sparsely 9 (30%) Densely 21 (70%) Ki67 index, median (IQR), [total n] 2.0 (3.8) 36 Ki67 index ≥3%, n (%) 14 (39%) 36 p53 positivity, median (IQR), [total n] 1 (26.5) 9 Invasion, n (%), [total n] 34 (53%) 64 Hardy grade, n (%), [total n] 61 1 13 (21%) 2 22 (36%) 3 18 (30%) 4 8 (13%) Knosp grade, n (%), [total n] 35 0 5 (14%) 1 12 (34%) 2 3 (9%) 3 7 (20%) 4 8 (7%) Disease - specific death, n (%), [total n] 5 (9%) 58 a Pharmacological treatments: pasireotide (n=6), ketoconazole (n=5), mitotane (n=5), temozolamide (n=4) metyrapone (n=5), cabergoline (n=3), bevazizumab (n=1). Five patients received >1 pharmacological agent. 2 Supplementary Table 2 . Primers used for TP53 amplification and Sanger sequencing. Primer Sequence DNA source TP53 - 1 5' - TCTCATGCTGGATCCCCACT - 3' FF, FFPE TP53 - 1rv 5' - GACCAGGTCCTCAGCC - 3' FFPE TP53 - 2fw 5' - GGGGGCTGAGGACCTGGT - 3' FFPE TP53 - 2rv 5' - ATACGGCCAGGCATTGAAGT - 3' FFPE TP53 - 2 5' - AGAGGAATCCCAAAGTTCCA - 3' FF TP53 - 3 5' - GTGCCCTGACTTTCAACTC - 3' FF, FFPE TP53 - 3rv 5' - GGCAACCAGCCCTGTC - 3' FFPE TP53 - 4fw 5' - GCCTCTGATTCCTCACTGAT - 3' FFPE TP53 - 4 5' - CAGGAGAAAGCCCCCCTACT - 3' FF, FFPE TP53 - 5 5' - CTTGCCACAGGTCTCCCCAA - 3' FF, FFPE TP53 - 6 5' - AGGGGTCAGAGGCAAGCAGA - 3' FF, FFPE TP53 - 7 5' - TAGGACCTGATTTCCTTA - 3' FF, FFPE TP53 - 7rv 5' - AGTGAATCTGAGGCATAAC - 3' FFPE TP53 - 7Bfw 5' - TGGAGGAGACCAAGGGTG - 3' FFPE TP53 - 7Brv 5' - CGGCATTTTGAGTGTTAGAC - 3' FFPE TP53 - 8 5' - TAAGCTATGATGTTCCTTAG - 3' FF, FFPE TP53 - 8rv 5' - GACTGTTTTACCTGCAATTG - 3' FFPE TP53 - 9 5' - CAATTGTAACTTGAACCATC - 3' FF, FFPE TP53 - 10 5' - GGATGAGAATGGAATCCTAT - 3' FF, FFPE TP53 - 11 5' - TCTCACTCATGTGATGTCATC - 3' FF, FFPE TP53 - 12 5' - CACACCTATTGCAAGCAAGG - 3' FF, FFPE FF, fresh frozen; FFPE, formalin - fixed paraffin embedded. figshare Download Additional file 1 Additional file 1. Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS. Additional file 1 . Supplementary Table 1: Description of study cohort. Supplementary Table 2: Primers used for TP53 amplification and Sanger sequencing. Supplementary Table 3: Common TP53 variants in the study cohort. Supplementary Table 4: Comparison of TP53 mutant versus TP53 wild type group. Supplementary Figure 1. Chromatograms showing the TP53 variants found in the corticotroph tumor of patient #1 and #8 (Table 1). A. The variant c.398T>A was present in homozygocity in the tumor and absent in the blood. B. The variant c.1009C>G is detected in all available surgical specimens in this patient. First and 2nd surgeries were Cushing’s disease tumors and 4th and 5th CTP-BADX/NS. Rights and permissions Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Reprints and Permissions From https://actaneurocomms.biomedcentral.com/articles/10.1186/s40478-022-01437-1#Abs1

By Ed Miseta, Chief Editor, Clinical Leader Follow Me On Twitter @EdClinical Sparrow Pharmaceuticals is an emerging biopharma company on a mission to help patients suffering from an excess of corticosteroids, with a focus on Cushing’s syndrome, autonomous cortisol secretion (ACS), and polymyalgia rheumatica (PMR). Cushing’s and ACS are both caused by an excess of cortisol produced by tumors. Patients with Cushing’s can present physically with a fatty hump between their shoulders, a rounded face, and pink or purple stretch marks on their skin. Cushing’s syndrome and ACS can both result in high blood pressure, bone loss, type 2 diabetes, weight gain, and mood, cognition, and sleep disorders. Any of those symptoms may be side effects for patients with conditions such as PMR who rely on long-term treatment with corticosteroid medications such as prednisone. “Cushing’s syndrome impacts around 20,000 patients in the U.S. alone,” says David Katz, Chief Scientific Officer for Sparrow. “Approximately 50% of those patients can be cured by surgery, but some will develop another tumor years later. ACS is an under-recognized condition, but it may affect up to 3 million patients in the U.S. There are also around 2 million people in the U.S. who rely on long-term use of corticosteroid medications to control autoimmune diseases and other conditions.” The treatments being developed by Sparrow are based on recognition that cortisol and corticosteroid medications are activated in certain tissues such as the liver, bone, fat, and brain, where in excess they act to cause toxicity. The company’s investigational drugs inhibit HSD-1, the enzyme responsible for that activation. Sparrow is about to launch a Phase 2 trial for Cushing’s syndrome. In early 2022 the company will also begin two additional Phase 2 trials for ACS and PMR, a common autoimmune disease in elderly patients. PMR is an arthritic syndrome characterized by a phenomenon known as claudication, which means the more you use a limb, the more it hurts and the harder it is to use. “For example, the more a PMR patient walks, the more painful and stiff their legs will become,” says Katz. “If they're trying to do anything with their arms, the arms will get stiffer and more painful. The disease is pretty debilitating in terms of physical function. The only approved treatment for PMR is steroids, which have side effects such as diabetes, hypertension, osteoporosis, and fractures.” Unknown Clinical Challenges Katz is excited about the clinical trials for ACS and PMR because no sizable interventional trials have been reported in either of those conditions. “We're going into a completely new area, and we don't know what we're going to encounter in terms of patient recruitment and retention,” says Katz. “There is also no strong precedent for how to get approval for a drug in these conditions. The only treatment indicated for PMR is steroids, and that came without any efficacy clinical trials. There are no drugs approved for ACS. It’s hard to anticipate the challenges we will face when we are in an area that is very new.” Patient centricity is a topic that is very important to Katz, and he spends a lot of time thinking about how to make trials a more pleasant experience for patients by limiting the burden placed on them. He notes that can sometimes be a difficult trade-off because of the procedures that must be performed to meet regulatory standards. “In Cushing’s syndrome clinical care and clinical trials, the standard way for someone's cortisol level to be measured is a 24-hour urine collection,” states Katz. “That involves looking at the amount of cortisol in the urine over a 24-hour period. That collection is inconvenient and burdensome, and the patient must then carry it somewhere to be analyzed.” Sparrow hopes to shift that collection to a spot urine sample, like what patients would experience during a physical. The patient would urinate into a cup and hand it off to a clinic employee for analysis. The process would be much simpler and less burdensome for the patient. Sparrow will first need to prove that in a clinical trial the spot sample will work as well or better than the 24-hour collection. Subjects in the initial clinical trials will have to contribute the 24-hour collections so that Sparrow can demonstrate that future patients will not need to do so. The Future of Endocrinology Katz has a positive outlook on the future of endocrinology. Sparrow’s leading drug candidate, SPI-62, is an oral, small-molecule HSD-1 inhibitor. In four clinical trials, it demonstrated potent targeting of HSD-1 in both the brain and liver, and significantly lowered cortisol levels in the liver. The studies also showed a favorable safety and tolerability profile. “If we are successful at developing SPI-62, I believe it will change the field of endocrinology,” says Katz. “We aim to shift the focus in Cushing’s syndrome to intracellular cortisol as the main driver of symptoms. What I mean by that is if we find that SPI-62 substantially reduces symptoms and that the degree of inhibition of our target HSD-1 correlates well with clinical improvement, then we can get to a new standard of care. We can potentially get rid of the 24-hour urine collections, which will be a big relief to patients. Additionally, many of today's drugs have a side effect called adrenal insufficiency, which results when the drugs either reduce cortisol too much or completely block activity. Many of today's drugs also require frequent monitoring and dose titration to prevent adrenal insufficiency. We believe that with HSD-1 inhibition we might avoid adrenal insufficiency as well.” Katz is hopeful patients treated with SPI-62 will not require monitoring and dose titration. That proof will take years and lots of clinical trials. Sparrow may also produce the first targeted therapy for ACS. That could improve the recognition of ACS as a prevalent form of hypercortisolism and a substantial cause of morbidity and mortality. “ACS is probably the most under-recognized condition in endocrinology based on recent epidemiological studies,” adds Katz. “It's possible that as few as 3% of patients who have ACS actually have a diagnosis. That is shocking for a condition that is associated with a lot of cardiometabolic and bone morbidity, negative effects on mood and cognition, sleep, and muscle strength, and is associated with excess mortality. We want to bring attention to this condition by bringing out a targeted therapy to treat a spectrum of symptoms by getting to the root cause of them.” From https://www.clinicalleader.com/doc/sparrow-pharmaceuticals-hopes-to-change-the-future-of-endocrinology-0001

An international panel reached consensus for pre- and postoperative endocrine testing to manage adults undergoing transsphenoidal surgery, including measurement of prolactin and insulin-like growth factor I levels for all pituitary tumors. In adults and children, transsphenoidal surgery represents the cornerstone of management for most large or functioning sellar lesions with the exception of prolactinomas, Maria Fleseriu, MD, FACE, an Endocrine Today Editorial Board Member, professor of medicine and neurological surgery and director of the Pituitary Center at Oregon Health & Science University in Portland, and colleagues wrote in Pituitary. Endocrine evaluation and management are an essential part of perioperative care; however, the details of endocrine assessment and care are not universally agreed on. “Perioperative management of patients undergoing pituitary surgery is fascinating, as it involves many specialties — endocrinology, neurosurgery and ENT — and patients also get discharged very quickly in some countries, such as the United States,” Fleseriu told Healio. “At the start of the COVID-19 pandemic, the Physician Education Committee of the Pituitary Society, comprised of members from four continents, met to discuss a more streamlined process for workup before and after surgery for patients undergoing pituitary surgery. We have noticed big differences in management, but also some common themes, and decided to have a formal evaluation using a Delphi consensus and a much larger representation, with members from five continents.” Building consensus The task force behind the project, co-led by Nicholas A. Tritos, MD, DSc, associate professor of medicine at Harvard Medical School, and Pouneh K. Fazeli, MD, MPH, director of the neuroendocrinology unit and associate professor of medicine at University of Pittsburgh School of Medicine, created 35 questions and invited 55 pituitary endocrinologists to answer the questions in two Delphi rounds. Participants rated their extent of agreement with statements pertaining to perioperative endocrine evaluation and management, using a Likert-type scale. Strong consensus, defined as at least 80% of panelists rating their agreement as 6 to 7 on a scale from 1 to 7, was achieved for 24 of 35 items. Less strict agreement, defined as ratings of 5 to 7, was reached for 31 of 35 items. There were several significant findings, Fleseriu said. Despite uncertainty in previous guidelines, panelists reached consensus to measure serum IGF-I for all patients with pituitary tumors preoperatively to ensure proper diagnosis of growth hormone excess, Fleseriu said. “This is important because patients with GH-secreting adenomas do not always present with classic manifestations of acromegaly, require additional evaluation for comorbidities and postoperatively may benefit from further medical therapy or other adjuvant treatment,” Fleseriu said. Panelists also expressed agreement on preoperative administration of glucocorticoid and thyroid hormone replacement for patients with diagnosed deficiencies, as well as perioperative use of stress-dose glucocorticoid coverage for patients with known or suspected hypoadrenalism, but not for all patients undergoing transsphenoidal surgery. Panelists also agreed on postoperative monitoring of serum sodium and cortisol and the use of desmopressin on-demand, required to control hypernatremia and/or polyuria, for patients with central diabetes insipidus. “Agreement was achieved on postoperative monitoring of endocrine function, including morning serum cortisol in patients with Cushing’s disease, as well as serum IGF-I in patients with acromegaly,” Fleseriu said. More research needed Panelists did not reach consensus for a minority of items, representing areas where further research is needed, including measuring serum prolactin in dilution for all patients with large macroadenomas, Fleseriu said. “Prolactin immunoassays can be susceptible to the ‘hook effect’ artifact, which may lead to substantial underreporting of prolactin values in sera containing very high prolactin concentrations, thus having important implications for patient management,” Fleseriu said. “Newer automated immunoassay platforms are likely to detect the hook effect; however, this may not be the case in older assays, which are still in use in many countries or laboratories. Therefore, especially when surgery is performed at an institution where automated assays are available to detect hook effect, yet patient workup has been carried out at an outside laboratory, additional lab workup might be needed. We envision this scenario can occur more often with the widespread use of telemedicine and endocrine testing being carried out at a distant laboratory.” Additionally, there was a lack of consensus regarding preoperative testing for hypercortisolism in all patients with an apparently nonfunctioning pituitary adenoma. “This might reflect concern about false-positive results of endocrine testing in some individuals,” Fleseriu said. “On the other hand, published data suggest that some patients with Cushing’s disease may lack typical symptoms and signs and can present with an incidentally found sellar mass.” Panelists did not reach consensus on items concerning preoperative medical therapy for patients with acromegaly or Cushing’s disease, potentially reflecting differences in practice among international centers, the clinical heterogeneity of patient populations, and ongoing uncertainties regarding the benefits of preoperative medical therapy. “Single-center clinical experience suggests that preoperative medical therapy may be helpful in patients with Cushing’s disease and severe acute psychiatric illness or sepsis,” Fleseriu said. “Studies on acromegaly have very discordant results. “With this study — the largest international Delphi consensus on perioperative management of patients undergoing pituitary surgery — we identified key steps in protocols which are ready to be implemented in most centers, especially for preoperative evaluation, sodium abnormalities and glucocorticoids administration postop,” Fleseriu said. “We have also highlighted several areas where need for more research is needed to optimize patients’ outcomes.” For more information: Maria Fleseriu, MD, FACE, can be reached at fleseriu@ohsu.edu; Twitter: @MariaFleseriu. From https://www.healio.com/news/endocrinology/20210810/experts-offer-recommendations-for-management-of-pituitary-tumors

Braun LT, Fazel J, Zopp S Journal of Bone and Mineral Research | May 22, 2020 This study was attempted to assess bone mineral density and fracture rates in 89 patients with confirmed Cushing's syndrome at the time of diagnosis and 2 years after successful tumor resection. Researchers ascertained five bone turnover markers at the time of diagnosis, 1 and 2 years postoperatively. Via chemiluminescent immunoassays, they assessed bone turnover markers osteocalcin, intact procollagen‐IN‐propeptide, alkaline bone phosphatase, CrossLaps, and TrAcP 5b in plasma or serum. For comparison, they studied 71 gender‐, age‐, and BMI‐matched patients in whom Cushing's syndrome had been excluded. The outcomes of this research exhibit that the phase immediately after surgical remission from endogenous CS is defined by a high rate of bone turnover resulting in a striking net increase in bone mineral density in the majority of patients. Read the full article on Journal of Bone and Mineral Research.

Lacroix A, et al. Pituitary. 2019;doi:10.1007/s11102-019-01021-2. January 7, 2020 Andre Lacroix Most adults with persistent or recurrent Cushing’s disease treated with the somatostatin analogue pasireotide experienced a measurable decrease in MRI-detectable pituitary tumor volume at 12 months, according to findings from a post hoc analysis of a randomized controlled trial. “Pasireotide injected twice daily during up to 12 months to control cortisol excess in patients with residual or persistent Cushing's disease was found to reduce the size of pituitary tumors in a high proportion of the 53 patients in which residual tumor was still visible at initiation of this medical therapy,” Andre Lacroix, MD, FCAHS, professor of medicine at the University of Montreal Teaching Hospital in Montreal, Canada, told Healio. “Pituitary tumors causing Cushing's syndrome which cannot be removed completely by surgery have the capacity to grow in time, and a medical therapy that can reduce tumor growth in addition to control excess cortisol production should be advantageous for the patients.” Lacroix and colleagues analyzed data from 53 adults with persistent or recurrent Cushing’s disease, or those with newly diagnosed Cushing’s disease who were not surgical candidates, who had measurable tumor volume data (78% women). Researchers randomly assigned participants to 600 g or 900 g subcutaneous pasireotide (Signifor LAR, Novartis) twice daily. Tumor volume was assessed independently at 6 and 12 months by two masked radiologists and compared with baseline value and urinary free cortisol response. Most adults with persistent or recurrent Cushing’s disease treated with the somatostatin analogue pasireotide experienced a measurable decrease in MRI-detectable pituitary tumor volume at 12 months. Source: Shutterstock Researchers found that reductions in tumor volume were both dose and time dependent. Tumor volume reduction was more frequently observed at month 6 in the 900 g group (75%) than in the 600 g group (44%). Similarly, at month 12 (n = 32), tumor volume reduction was observed more frequently in the 900 g group (89%) than in the 600 g group (50%). Results were independent of urinary free cortisol levels. The researchers did not observe a relationship between baseline tumor size and change in tumor size. “Taken together, the results of the current analysis demonstrate that treatment with pasireotide, a pituitary-directed medical therapy that targets somatostatin receptors, can frequently lead to radiologically measurable reductions in pituitary tumor volume in patients with Cushing’s disease,” the researchers wrote. “Tumor volume reduction is especially relevant in patients with larger microadenomas, suggesting that pasireotide is an attractive option for these patients, especially in cases in which patients cannot undergo transsphenoidal surgery or do not respond to surgical management of disease.” – by Regina Schaffer For more information: Andre Lacroix, MD, FCAHS, can be reached at the University of Montreal Teaching Hospital, Endocrine Division, 3840 Saint-Urbain, Montreal, H2W 1T8, Canada; email: andre.lacroix@umontrael.ca. Disclosures: Novartis supported this study and provided writing support. Lacroix reports he has received funding from Novartis Pharmaceuticals to conduct clinical studies with pasireotide and osilodrostat in Cushing’s disease and served as a consultant, advisory board member or speaker for EMD Serono, Ipsen and Novartis. Please see the study for all other authors’ relevant financial disclosures. From https://www.healio.com/endocrinology/neuroendocrinology/news/online/%7B8e4d31fb-d61a-4cf8-b4c4-7d0bdf012fbd%7D/pasireotide-reduces-pituitary-tumor-volume-in-cushings-disease

Presented by Andrew Lin, MD Neuro-Oncologist & Neurologist Memorial Sloak Kettering Cancer Center After registering you will receive a confirmation email with details about joining the webinar. Contact us at webinar@pituitary.org with any questions or suggestions. Date: September 18, 2019 Time: 10:00 AM - 11:00 AM. Pacific Daylight Time, 1:00 PM - 2:00 PM Eastern Daylight Time Learning Objectives: During the conversation I will be: 1) Defining aggressive pituitary tumors. 2) Reviewing the current treatment options for aggressive pituitary tumors. 3) Discussing experimental treatment options including a phase II trial investigating the activity of the immunotherapies nivolumab and ipilimumab. Presenter Biography: I am a neuro-oncologist at Memorial Sloan Kettering Cancer Center (MSK) and a member of the Multidisciplinary Pituitary & Skull Base Tumor Center. In collaboration with my colleagues in endocrine, neurosurgery, and radiation oncology, I treat patients with aggressive pituitary tumors, who are resistant to conventional treatments (i.e. surgery and radiation), with chemotherapy. With my colleagues at MSK, I have published several research articles on pituitary tumors and opened several clinical trials.

Patients with Cushing’s disease may develop post-traumatic stress symptoms, which are generally resolved once they undergo surgery to remove the tumor, but can persist in some cases, a study shows. The study, “Posttraumatic stress symptoms (PTSS) in patients with Cushing’s disease before and after surgery: A prospective study,” was published in the Journal of Clinical Neuroscience. Cushing’s disease is an endocrine disorder characterized by excess secretion of the adrenocorticotropic hormone (ACTH) by a pituitary adenoma (tumor of the pituitary gland). This leads to high levels of cortisol, a condition known as hypercortisolism. Chronic hypercortisolism is associated with symptoms such as central obesity, buffalo hump, body bruising, muscle weakness, high blood pressure, high blood sugar, and weak bones. Additionally, patients can develop psychiatric disorders including depression, anxiety, and cognitive dysfunction, all of which contribute considerably to a lower health-related quality of life. Depression and anxiety rates are particularly high in Cushing’s disease patients, with 54% of them experiencing major depression and 79% having anxiety. Due to the significant impact of psychological factors in these patients, they may be susceptible to post-traumatic stress symptoms (PTSS). But more information on this phenomenon in these patients is still needed. To address this lack of data, a group of Chinese researchers conducted a prospective study to investigate the occurrence, correlated factors, and prognosis of PTSS in patients with Cushing’s disease. A total of 49 patients newly diagnosed with Cushing’s disease who underwent transsphenoidal removal of the tumor as their first-line treatment were asked to participate in this study. Another group of 49 age- and sex-matched healthy individuals were included as controls. PTSS was measured using the Impact of Event Scale-Revised (IES-R), depression/anxiety were measured using the Hospital Anxiety and Depression scale (HADS), and quality of life was measured using the 36-item short-form (SF-36). These parameters were measured before surgery, and then at six and 12 months after the procedure. Before surgery, 15 patients (30.6%) had PTSS. These patients also had higher cortisol levels, worse levels of depression/anxiety, and worse quality of life scores than those without PTSS. While most of the patients recovered after the operation, there were five (33.3%) for whom PTSS persisted for more than a year. Additionally, one patient who had a recurrence of Cushing’s disease developed PTSS between six and 12 months after the first surgery. PTSS severity showed consistent improvement after surgery, which was correlated with better depression/anxiety scores and psychological aspects of the SF-36. However, Cushing’s disease patients in remission still performed worse than healthy individuals concerning their physical and mental health. Therefore, “patients with [Cushing’s disease] can develop PTSS, and they may persist for over a year even after successful surgery. Combined psychological intervention is advised for these patients,” the researchers concluded. From https://cushingsdiseasenews.com/2019/06/25/cushings-patients-often-have-post-traumatic-stress-symptoms

Patna: Improper functioning of the Pituitary gland usually results in excess or under production of hormones that leads to a formation of mass called tumor, which can be benign or malignant. Such tumors in this gland can create numerous serious medical conditions by interfering with the normal functioning of the endocrine system and pituitary gland. “Though the occurrence of tumor is more likely after the age of 30 years, it still can impact at an early age. The survival rates of tumor due to its complicated location also depend on other factors like the patient’s age, type and size of tumor. Mostly, pituitary gland tumors are non cancerous but the exact causes are unknown. Some of them are hereditary and some are caused by a rare genetic disorder called as multiple endocrine neoplasia type 1. This disorder can also lead to over-activity or enlargement of 3 different endocrine-related glands, which also includes the pituitary gland. “Dr Aditya Gupta, Director, Neurosurgery, Agrim institute for neuro sciences, Artemis Hospital Diagnosis at an early stage can help the treatment procedure to be totally non-invasive with the use of advances technology called as Cyberknife. Cyberknife which is the most advanced radiation therapy is completely non-invasive therapy available for the treatment of benign as well as malignant tumors. This therapy works the best for some pituitary tumors that are upto 2 cm in size and is a very powerful and effective technique for treating patients suffering from early stage primary and medically inoperable tumors. The treatment is safe to administer and also offers a new option in patients with recurrent disease or a single disease in the body. “Highlights of the therapy being ease of access to any complex location without the need to use the surgical knife, precision of the beam with high dose radiation to the tumor location, and the safety. It is a day care procedure without pain and risk, and the patient can get back to daily chores as soon as the session gets over which depends on the tumor typically (30 minutes) and hence eliminates the requirement of any hospital stay.” Added Dr Gupta Depending upon the hormonal variations in the body, there can be a variety of symptoms. The most common symptoms include Headaches, vision problem, tiredness, mood changes, irritability, changes in menstrual cycle in women, impotence, infertility, Inappropriate breast growth or production of breast milk, Cushing’s syndrome which is a combination of weight gain, high blood pressure, diabetes, and easy bruising, the enlargement of the extremities or limbs, thickening of the skull and jaw caused by too much growth hormone. Pituitary gland, which is also known as the master gland has the most important function of producing hormones that regulates the critical organs of the body including thyroid, adrenal glands, ovaries and testes. It is a small pea-size gland located behind the eyes and below the front of the brain. Some tumors produce hormones known as functional tumors, and others can cause the glands to secrete too few or too many hormones. Also if the tumor pressed on the nearby structure, for instance the optic nerve, can also limit a person’s vision. Moreover the procedure makes use of the most sophisticated image guidance technique to focus high doses of radiation directly to the tumor spot which eliminates the chances to damage the healthy cells as in any other methods of treatment. “Each session of treatment usually lasts for about 30 -50 min and is cost effective with a success rate of 98% in such complicated tumors. Patients with pituitary adenomas receive stereotactic radio surgery with CyberKnife and are followed up for more than 12 months. After 2-3 weeks of therapy patients are monitored for positive responses and ensure there is no recurrence of any mass. Stereotactic radio surgery with the CyberKnife is effective and safe against pituitary adenomas.” Said Dr Gupta From https://www.apnnews.com/hormonal-imbalance-indication-of-pituitary-gland-tumors-2/

Pituitary Tumors Affect Patients’ Ability to Work, Reduce Quality of Life Pituitary tumor conditions, such as Cushing’s disease, have a substantial effect on patients’ work capabilities and health-related quality of life, researchers from The Netherlands reported. The study, “Work disability and its determinants in patients with pituitary tumor-related disease,” was published in the journal Pituitary. Pituitary tumors, like those that cause Cushing’s disease, have significant effects on a patient’s physical, mental, and social health, all of which influence their work status and health-related quality of life. However, the effects of the disease on work status is relatively under-investigated, investigators report. Here, researchers evaluated the work disability among patients who were treated for pituitary tumors in an attempt to understand the impact of disease diagnosis and treatment on their social participation and ability to maintain a paying job. In their study, researchers examined 241 patients (61% women) with a median age of 53 years. The majority (27%) had non-functioning pituitary tumors, which do not produce excess hormones, but patients with acromegaly, Cushing’s disease, prolactinomas, and Rathke’s cleft cyst also were included. Participants were asked to complete questionnaires to evaluate their health-related quality of life and disease-specific impact on their work capabilities. Each participant completed a set of five questionnaires. Participants also reported their hormonal status and demographic data, including gender, age, education, and marital status. Specific information, such as disease diagnosis, treatment, and tumor type was obtained from their medical records. Work status and productivity were assessed using two surveys, the Short-Form-Health and Labour Questionnaire (SF-HLQ) and the work role functioning questionnaire 2.0 (WRFQ). SF-HLQ was used to obtain information on the participants’ employment and their work attendance. Employment was either paid or unpaid. (Participation in household chores was considered not having a paid job.) WRFQ is a 27-question survey that determines work disability regarding being able to meet the productivity, physical, emotional, social, and flexible demands. A higher score indicates low self-perceived work disability. Disease-specific mood problems, social and sexual functioning issues, negative perceptions due to illness, physical and cognitive difficulties, were assessed using a 26-item survey called Leiden Bother and Needs for Support Questionnaire for pituitary patients(LBNQ-Pituitary). Overall, 28% of patients did not have a paid job, but the rates increased to 47% among those with Cushing’s disease. Low education, hormonal deficits, and being single were identified as the most common determinants of not having a paid job among this population. Further analysis revealed that more patients with Cushing’s disease and acromegaly had undergone radiotherapy. They also had more hormonal deficits than others with different tumor types. Overall, patients with a paid job reported working a median of 36 hours in one week and 41% of those patients missed work an average of 27 days during the previous year. Health-related problems during work also were reported by 39% with a paid job. Finally, health-related quality of life was determined using two questionnaires: SF-36 and EQ-5D. The physical, mental, and emotional well being was measured with SF-36, while ED-5D measured the health outcome based on the impact of pain, mobility, self-care, usual activities, discomfort, and anxiety or depression. In both SF-36 and EQ-5D, a higher score indicates a better health status. Statistical analysis revealed that the quality of life was significantly higher in patients with a job. Overall, patients with a paid job reported better health status and higher quality of life than those without a paid job. Although 40% of the patients reported being bothered by health-related problems in the past year, only 12% sought the help of an occupational physician, the researchers reported. “Work disability among patients with a pituitary tumor is substantial,” investigators said. “The determinants and difficulties at work found in this study could potentially be used for further research, and we advise healthcare professionals to take these results into consideration in the clinical guidance of patients,” they concluded. From https://cushingsdiseasenews.com/

The chemotherapy temozolomide partially improved a case of an aggressive pituitary tumor that caused symptoms of Cushing’s disease (CD), according to a new study in Poland. However, after tumor mass and cortisol levels were stabilized for a few months, the patient experienced rapid progression, suggesting that new methods for extending the effects of temozolomide are needed. The study, “Temozolomide therapy for aggressive pituitary Crooke’s cells corticotropinoma causing Cushing’s Disease: A case report with literature review,” appeared in the journal Endokrynologia Polska. Aggressive pituitary tumors are usually invasive macroadenomas, or benign tumors larger than 10 mm. A very rare subset of pituitary adenoma — particularly corticotropinoma, or tumors with excessive secretion of corticotropin (ACTH) — exhibit Crooke’s cells. These tumors are highly invasive, have a high recurrence rate, and are often resistant to treatment. Information is not widely available about the effectiveness of treating aggressive pituitary tumors, particularly those that cause Cushing’s disease. The management of these tumors usually requires neurosurgery, followed by radiotherapy, and pharmacotherapy. However, the chemotherapy medication temozolomide has been increasingly used as a first-line treatment after initial evidence of its effectiveness in treating glioblastoma, the most common form of brain cancer. In this study, researchers at the Jagiellonian University, in Poland, discussed the case of a 61-year-old man with ACTH-dependent Cushing’s syndrome caused by Crooke’s cell corticotropinoma. The patient first presented with symptoms of severe hypercorticoidism — the excessive secretion of steroid hormones from the adrenal cortex — in December 2011. He also showed advanced heart failure, severe headaches, and impaired vision, which had started two or three years before diagnosis. Examinations revealed osteoporosis and a fracture in the Th5 vertebra. His morning ACTH levels were high. The same was observed for mean cortisol levels even after dexamethasone treatment, which was suggestive of a pituitary tumor secreting ACTH. MRIs showed the existence of a tumor mass, later identified as a macroadenoma with high cell polymorphism, the presence of Crooke’s cells, and ACTH secretion. The patient was referred for transsphenoidal nonradical neurosurgery, performed through the nose and the sphenoid sinus, and bilateral adrenalectomy, or the surgical removal of the adrenal glands, in 2012-2013. However, he developed fast, postoperative recurrence of hypercorticoidism and tumor regrowth. This led to three additional transsphenoidal neurosurgeries and radiotherapy. The patient’s clinical status worsened as he developed severe cardiac insufficiency. Doctors began temozolomide treatment in April 2015, which did not result in adverse effects throughout treatment. The initial standard dose (150–200 mg/m2) was given once daily in the morning for five consecutive days, in a 28-day cycle. The patient also received 600 mg of ketoconazole, an antifungal medication. Ondansetron was administered to prevent nausea and vomiting. Subsequent examinations revealed clinical and biochemical improvements, including a reduction in ACTH and cortisol levels. In addition, the patient also showed reduced cardiac insufficiency, less frequent and less severe headaches, visual field improvements, and better physical fitness and mood. However, clinical symptoms worsened after the eighth temozolomide cycle. The tumor size also suddenly increased after the ninth cycle, reaching the inner ear. Temozolomide was then discontinued and ACTH levels increased by 28 percent one month later. The patient also demonstrated deteriorated vision, hearing loss, and strong headaches. Clinicians then decided to start treatment with the Cushing’s disease therapy Signifor (pasireotide), but a worsening of diabetes was observed, and the patient died in February 2016. “The most probable reason for death was compression of the brainstem, which had been observed in the last MRI of the pituitary,” the researchers wrote, adding that “due to the very short duration of treatment, any conclusions on the treatment with Signifor cannot be drawn.” Overall, “the results of the presented case suggest that [temozolomide] treatment monotherapy could have only partial response in aggressive corticotroph adenoma causing Cushing’s disease, followed by sudden progression,” the investigators wrote. This contrasts with mostly responsive cases reported in research literature, they noted. “Therefore, further research on the factors of responsiveness and on novel methods to extend the duration of the effect of [temozolomide] should be carried out,” they wrote. From https://cushieblog.com/2018/02/10/temozolomide-may-partially-improve-aggressive-pituitary-tumors-causing-cushings-disease/

Presented by Kenneth M. De Los Reyes MD, MSc Assistant Professor Co-director of Skull Base Surgery Director of Quality Assurance Department of Neurosurgery Loma Linda University Medical Center Register Now! After registering you will receive a confirmation email with details about joining the webinar. Contact us at webinar@pituitary.org with any questions or suggestions. Date: Wednesday, December 13, 2017 Time: 10:00 AM - 11:00 AM Pacific Standard Time 1:00 PM - 2:00 PM Eastern Standard Time Webinar Description Learning Objectives: Building Patient and Medical Provider Awareness To build awareness among patients and medical providers of early signs and symptoms of pituitary and pituitary related tumors To understand the consequences of delays in diagnosis of pituitary tumors To outline steps for patients and medical providers to take to prevent delays in diagnosis of pituitary tumors.

People with high cortisol levels have lower muscle mass and higher visceral fat deposits, putting them at a greater risk for cardiovascular disease, new research shows. High levels of cortisol can result from a variety of reasons, including Cushing’s disease and adrenal tumors. Most adrenal tumors are found to be non-functioning, meaning they do not produce excess hormones. However, up to 47 percent of patients have mild autonomous cortisol excess (MACE). The study, “Impact of hypercortisolism on skeletal muscle mass and adipose tissue mass in patients with adrenal adenomas,” was published in the journal Clinical Endocrinology. Long-term studies have shown that as a group, patients with MACE tend to have increased cardiovascular risk factors, such as hypertension, type 2 diabetes mellitus (DM2), obesity, and high lipid levels, which are associated with higher cardiovascular death rates. Abdominal adiposity, which refers to fat deposits around the abdomen and stomach, and central sarcopenia, referring to loss of skeletal muscle mass, are both known to be linked to higher cardiovascular risk and increased mortality. Overt hypercortisolism is known to lead to increased visceral adiposity (body fat stored within the abdominal cavity) and muscle loss. However, little is known about the body composition of patients with adrenal adenomas and MACE. Therefore, researchers set out to determine whether central sarcopenia and adiposity are present in patients with MACE, and whether they can be markers of disease severity in patients with adrenal adenomas. To determine this, researchers used body composition measurements of 25 patients with Cushing’s disease, 48 patients with MACE, and 32 patients with non-functioning adrenal tumors (NFAT) using abdominal CTs. Specifically, researchers looked at visceral fat, subcutaneous fat, and total abdominal muscle mass. Visceral fat refers to fat around organs, and it is “deeper” than subcutaneous fat, which is closer to the skin. Results showed that, compared to patients with non-functional tumors, those with Cushing’s disease had a higher visceral to total (V/T) fat ratio but a lower visceral to subcutaneous (V/S) fat ratio. In MACE patients, however, both ratios were decreased compared to patients with non-functional tumors. Cushing’s disease patients also had 10 cm2 less total muscle mass, compared to patients with non-functional tumors. An overnight dexamethasone suppression test was conducted in these patients to determine levels of cortisol in the blood. The next morning, cortisol levels were checked. High levels of cortisol indicate the presence of a disease, such as MACE or Cushing’s disease. After administering the test, researchers determined that for an increase in cortisol in the morning, there was a correlating increase in the V/T ratio and the V/S fat ratio, and a decrease in the mean total muscle mass. Therefore, the higher the degree of hypercortisolism, the lower the muscle mass and the higher the visceral adiposity. These results could prove to be clinically useful as both visceral adiposity and low muscle mass are risk factors of a number of diseases, including cardiovascular disease. “Body composition measurement may provide an additive value in making a diagnosis of clinically important MACE and aid in individualizing management of patients with ACAs and MACE,” the researchers concluded. From https://cushieblog.com/2017/12/01/high-cortisol-levels-as-seen-in-cushings-can-lead-to-greater-risk-of-heart-disease-study-finds/

CLCI699C2302: A Phase III, Multi-center, Randomized, Double-blind, 48 Week Study with an Initial 12 Week Placebo-controlled Period to Evaluate the Safety and Efficacy of Osilodrostat in Patients with Cushing’s Disease Purpose In people with a disorder known as Cushing’s disease, levels of the hormone cortisol are very high in the urine and blood. Lowering cortisol levels relieves the symptoms of Cushing’s disease. Osilodrostat is an investigational drug that inhibits an enzyme needed for cortisol to be made. In this study, researchers are assessing the safety and effectiveness of osilodrostat in patients with Cushing¿s disease and observing its ability to reduce cortisol levels. In the first 12 weeks of the study, patients will receive osilodrostat or a placebo (inactive drug). After week 12 and continuing through week 48, all patients will receive osilodrostat. Patients will then have the option to continue taking osilodrostat for up to 100 weeks into the study, if they wish. Osilodrostat is taken orally (by mouth). Eligibility To be eligible for this study, patients must meet several criteria, including but not limited to the following: Patients must have Cushing¿s disease with elevated levels of cortisol in the urine. An acceptable amount of time must have passed between the completion of prior therapies and entry into the study, to allow for a sufficient “washout” period. This study is for patients ages 18 to 75. For more information about this study and to inquire about eligibility, please contact Dr. Eliza Geer at 646-888-2627. Protocol 17-351 Phase III Investigator Eliza B. Geer Co-Investigators Monica Girotra Diseases Pituitary Tumor Locations Memorial Sloan Kettering Memorial Hospital From https://www.mskcc.org/cancer-care/clinical-trials/17-351

By: SHERRY BOSCHERT, Family Practice News Digital Network SAN FRANCISCO – The size of a pituitary tumor on magnetic resonance imaging in a patient with ACTH-dependent Cushing’s syndrome can’t differentiate between etiologies, but combining that information with biochemical test results could help avoid costly and difficult inferior petrosal sinus sampling in some patients, a study of 131 cases suggests. If MRI shows a pituitary tumor larger than 6 mm in size, the finding is 40% sensitive and 96% specific for a diagnosis of Cushing’s disease as the cause of adrenocorticotropic hormone (ACTH)-dependent Cushing’s syndrome, and additional information from biochemical testing may help further differentiate this from ectopic ACTH secretion, Dr. Divya Yogi-Morren and her associates reported at the Endocrine Society’s Annual Meeting. Pituitary tumors were seen on MRI in 6 of 26 patients with ectopic ACTH secretion (23%) and 73 of 105 patients with Cushing’s disease (69%), with mean measurements of 4.5 mm in the ectopic ACTH secretion group and 8 mm in the Cushing’s disease group. All but one tumor in the ectopic ACTH secretion group were 6 mm or smaller in diameter, but one was 14 mm. Because pituitary "incidentalomas" as large as 14 mm can be seen in patients with ectopic ACTH secretion, the presence of a pituitary tumor can’t definitively discriminate between ectopic ACTH secretion and Cushing’s disease, said Dr. Yogi-Morren, a fellow at the Cleveland Clinic. That finding contradicts part of a 2003 consensus statement that said the presence of a focal pituitary lesion larger than 6 mm on MRI could provide a definitive diagnosis of Cushing’s disease, with no further evaluation needed in patients who have a classic clinical presentation and dynamic biochemical testing results that are compatible with a pituitary etiology (J. Clin. Endocrinol. Metab. 2003;88:5593-602). The 6-mm cutoff, said Dr. Yogi-Morren, came from an earlier study reporting that 10% of 100 normal, healthy adults had focal pituitary abnormalities on MRI ranging from 3 to 6 mm in diameter that were consistent with a diagnosis of asymptomatic pituitary adenomas (Ann. Intern. Med. 1994;120:817-20). A traditional workup of a patient with ACTH-dependent Cushing’s syndrome might include a clinical history, biochemical testing, neuroimaging, and an inferior petrosal sinus sampling (IPSS). Biochemical testing typically includes tests for hypokalemia, measurement of cortisol and ACTH levels, a high-dose dexamethasone suppression test, and a corticotropin-releasing hormone (CRH) stimulation test. Although IPSS is the gold standard for differentiating between the two etiologies, it is expensive and technically difficult, especially in institutions that don’t regularly do the procedure, so it would be desirable to avoid IPSS if it’s not needed in a subset of patients, Dr. Yogi-Morren said. The investigators reviewed charts from two centers (the Cleveland Clinic and the M.D. Anderson Cancer Center, Houston) for patients with ACTH-dependent Cushing’s syndrome seen during 2000-2012. ACTH levels were significantly different between groups, averaging 162 pg/mL (range, 58-671 pg/mL) in patients with ectopic ACTH secretion, compared with a mean 71 pg/mL in patients with Cushing’s disease (range, 16-209 pg/mL), she reported. Although there was some overlap between groups in the range of ACTH levels, all patients with an ACTH level higher than 210 pg/mL had ectopic ACTH secretion. Median serum potassium levels at baseline were 2.9 mmol/L in the ectopic ACTH secretion group and 3.8 mmol/L in the Cushing’s disease group, a significant difference. Again, there was some overlap between groups in the range of potassium levels, but all patients with a baseline potassium level lower than 2.7 mmol/L had ectopic ACTH secretion, she said. Among patients who underwent a high-dose dexamethasone suppression test, cortisol levels decreased by less than 50% in 88% of patients with ectopic ACTH secretion and in 26% of patients with Cushing’s disease. Most patients did not undergo a standardized, formal CRH stimulation test, so investigators extracted the ACTH response to CRH in peripheral plasma during the IPSS test. As expected, they found a significantly higher percent increase in ACTH in response to CRH during IPSS in the Cushing’s disease group, ranging up to more than a 1,000% increase. In the ectopic ACTH secretion group, 40% of patients did have an ACTH increase greater than 50%, ranging as high as a 200%-300% increase in ACTH in a couple of patients. "Although there was some overlap in the biochemical testing, it is possible that it provides some additional proof to differentiate between ectopic ACTH secretion and Cushing’s disease," Dr. Yogi-Morren said. In the ectopic ACTH secretion group, the source of the secretion remained occult in seven patients. The most common identifiable cause was a bronchial carcinoid tumor, in six patients. Three patients each had small cell lung cancer, a thymic carcinoid tumor, or a pancreatic neuroendocrine tumor. One patient each had a bladder neuroendocrine tumor, ovarian endometrioid cancer, medullary thyroid cancer, or a metastatic neuroendocrine tumor from an unknown primary cancer. The ectopic ACTH secretion group had a median age of 41 years and was 63% female. The Cushing’s disease group had a median age of 46 years and was 76% female. Dr. Yogi-Morren reported having no financial disclosures. sboschert@frontlinemedcom.com On Twitter @sherryboschert From Famiiy Practice News

LA JOLLA, CA—Scientists at the Salk Institute for Biological Studies have identified a protein that drives the formation of pituitary tumors in Cushing’s disease, a development that may give clinicians a therapeutic target to treat this potentially life-threatening disorder. The protein, called TR4 (testicular orphan nuclear receptor 4), is one of the human body’s 48 nuclear receptors, a class of proteins found in cells that are responsible for sensing hormones and, in response, regulating the expression of specific genes. Using a genome scan, the Salk team discovered that TR4 regulates a gene that produces adrenocorticotropic hormone (ACTH), which is overproduced by pituitary tumors in Cushing’s disease (CD). The findings were published in the May 6 early online edition of Proceedings of the National Academy of Sciences. “We were surprised by the scan, as TR4 and ACTH were not known to be functionally linked,” says senior author Ronald M. Evans, a professor in Salk’s Gene Expression Laboratory and a lead researcher in the Institute’s Helmsley Center for Genomic Medicine. “TR4 is driving the growth and overexpression of ACTH. Targeting this pathway could therapeutically benefit treatment of CD.” In their study, Evans and his colleagues discovered that forced overexpression of TR4 in both human and mouse cells increased production of ACTH, cellular proliferation and tumor invasion rates. All of these events were reversed when TR4 expression was reduced. First described more than 80 years ago, Cushing’s disease is a rare disorder that is caused by pituitary tumors or excess growth of the pituitary gland located at the base of the brain. People with CD have too much ACTH, which stimulates the production and release of cortisol, a hormone that is normally produced during stressful situations. While these pituitary tumors are almost always benign, they result in excess ACTH and cortisol secretion, which can result in various disabling symptoms, including diabetes, hypertension, osteoporosis, obesity and psychological disturbances. Surgical removal of the tumors is the first-line therapy, with remission rates of approximately 80 percent; however, the disease recurs in up to 25 percent of cases. Drugs such as cabergoline, which is used to treat certain pituitary tumors, alone or in combination with ketoconazole, a drug normally used to treat fungal infections, have been shown to be effective in some patients with Cushing’s disease. More recently, mefipristone-best known as the abortion pill RU-486-was approved by the FDA to treat CD. Despite these advances in medical therapy, the Salk scientists say additional therapeutic approaches are needed for CD. “Pituitary tumors are extremely difficult to control,” says Michael Downes, a senior staff scientist in the Gene Expression Laboratory and a co-author of the study. “To control them, you have to kill cells in the pituitary gland that are proliferating, which could prevent the production of a vital hormone.” Previous studies have found that, by itself, TR4 is a natural target for other signaling molecules in the pituitary. Small-molecule inhibitors that have been developed for other cancers could be potentially applied to disrupt this signaling cascade. “Our discovery,” says Evans, a Howard Hughes Medical Institute investigator and holder of the March of Dimes Chair in Molecular and Developmental Biology, “might lead clinicians to an existing drug that could be used to treat Cushing’s disease.” Source: Salk Institute

The Surgeon, 03/04/2013 Clinical Article Toniato A et al. – The purpose of this study was to ascertain whether minimally–invasive surgery is a safe and effective treatment for adrenal carcinoma and metastases. This study shows that laparoscopic resection is inappropriate for patients with known or suspected adrenocortical carcinoma, while the laparoscopic approach can be justified and is feasible in case of adrenal metastases. Read this article at http://www.mdlinx.com/endocrinology/newsl-article.cfm/4458602/ZZ4747461521296427210947/?news_id=561&newsdt=030413&utm_source=Newsletter&utm_medium=DailyNL&utm_content=General-Article&utm_campaign=Article-Section